ID: 1102646282

View in Genome Browser
Species Human (GRCh38)
Location 12:114405934-114405956
Sequence CGCTCCTCCTTTACACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646275_1102646282 15 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88
1102646276_1102646282 12 Left 1102646276 12:114405899-114405921 CCAAGAGCACCGGCAACCATATA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88
1102646277_1102646282 3 Left 1102646277 12:114405908-114405930 CCGGCAACCATATAATCTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88
1102646278_1102646282 -4 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646282 12:114405934-114405956 CGCTCCTCCTTTACACCCCCAGG 0: 1
1: 1
2: 1
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646282 Original CRISPR CGCTCCTCCTTTACACCCCC AGG Intronic