ID: 1102646283

View in Genome Browser
Species Human (GRCh38)
Location 12:114405935-114405957
Sequence GCTCCTCCTTTACACCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646275_1102646283 16 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1102646277_1102646283 4 Left 1102646277 12:114405908-114405930 CCGGCAACCATATAATCTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1102646276_1102646283 13 Left 1102646276 12:114405899-114405921 CCAAGAGCACCGGCAACCATATA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167
1102646278_1102646283 -3 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646283 12:114405935-114405957 GCTCCTCCTTTACACCCCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646283 Original CRISPR GCTCCTCCTTTACACCCCCA GGG Intronic