ID: 1102646288

View in Genome Browser
Species Human (GRCh38)
Location 12:114405947-114405969
Sequence CACCCCCAGGGAGGGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646276_1102646288 25 Left 1102646276 12:114405899-114405921 CCAAGAGCACCGGCAACCATATA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646280_1102646288 -8 Left 1102646280 12:114405932-114405954 CCCGCTCCTCCTTTACACCCCCA 0: 1
1: 0
2: 2
3: 49
4: 483
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646277_1102646288 16 Left 1102646277 12:114405908-114405930 CCGGCAACCATATAATCTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646281_1102646288 -9 Left 1102646281 12:114405933-114405955 CCGCTCCTCCTTTACACCCCCAG 0: 1
1: 0
2: 3
3: 49
4: 454
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646278_1102646288 9 Left 1102646278 12:114405915-114405937 CCATATAATCTCAGTGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646275_1102646288 28 Left 1102646275 12:114405896-114405918 CCTCCAAGAGCACCGGCAACCAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271
1102646279_1102646288 -7 Left 1102646279 12:114405931-114405953 CCCCGCTCCTCCTTTACACCCCC 0: 1
1: 0
2: 0
3: 36
4: 357
Right 1102646288 12:114405947-114405969 CACCCCCAGGGAGGGAAAGTTGG 0: 1
1: 0
2: 1
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646288 Original CRISPR CACCCCCAGGGAGGGAAAGT TGG Intronic