ID: 1102646416

View in Genome Browser
Species Human (GRCh38)
Location 12:114406698-114406720
Sequence TCTGGTGGCCCCACTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 12, 3: 47, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646416_1102646426 4 Left 1102646416 12:114406698-114406720 CCCCACCCAGTGGGGCCACCAGA 0: 1
1: 0
2: 12
3: 47
4: 197
Right 1102646426 12:114406725-114406747 CCCTGCTCCAGGTGTACACAAGG 0: 1
1: 0
2: 1
3: 21
4: 196
1102646416_1102646422 -7 Left 1102646416 12:114406698-114406720 CCCCACCCAGTGGGGCCACCAGA 0: 1
1: 0
2: 12
3: 47
4: 197
Right 1102646422 12:114406714-114406736 CACCAGACGTCCCCTGCTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646416 Original CRISPR TCTGGTGGCCCCACTGGGTG GGG (reversed) Intronic
900302830 1:1986490-1986512 CCTGGTGCCCCCAGAGGGTGAGG + Intronic
900479083 1:2889627-2889649 TCTGGGGGCCCCGCTGGAAGAGG + Intergenic
900489276 1:2938810-2938832 TCTGGGGCCCCCACTGTGTGGGG + Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901631965 1:10652348-10652370 TCTGCTGGCTCCACGGCGTGGGG + Intronic
902370873 1:16006115-16006137 TCGGGTGACCCCCATGGGTGGGG + Exonic
902605390 1:17566292-17566314 TTTGGTTGCCACACTAGGTGGGG - Intronic
902612805 1:17607182-17607204 TGTGGTGGCTCGGCTGGGTGTGG + Intronic
904034515 1:27551588-27551610 GCTGTTGGCCAAACTGGGTGAGG + Exonic
904613662 1:31738559-31738581 TTGGGTGGCTCCTCTGGGTGAGG - Intronic
904908619 1:33917125-33917147 TCTGGTGGAGGCCCTGGGTGCGG - Intronic
905913341 1:41668850-41668872 TCTGGTGCCCCTACTAGGTTAGG + Intronic
906520950 1:46466620-46466642 TCTGGCGGCCCCTCGGGGAGCGG + Intergenic
910175169 1:84422262-84422284 TCTAGGGGCCACACTGGGTGAGG + Intergenic
912225143 1:107724807-107724829 TCTGGTTGCAACACTGGATGTGG + Intronic
913009508 1:114669732-114669754 TCTCGTGGCCGCACGGGTTGTGG - Intronic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915105621 1:153533603-153533625 TCTTCTGTCCCCACTGGGTGGGG - Intergenic
915213043 1:154324309-154324331 TGTGGTGGCCCCTCTGGTGGGGG + Exonic
915280377 1:154818376-154818398 GCTGCTGGCCCCCCTGGGAGAGG - Intronic
916159026 1:161890410-161890432 TCTGGAGACCCCATTTGGTGAGG + Intronic
917495804 1:175539066-175539088 TCTGGTCTCCCCAGTCGGTGAGG + Intronic
917788551 1:178485286-178485308 TCTGATGGCTCCATTGGCTGGGG + Intergenic
920956237 1:210622462-210622484 TCTGGGAGCCCCTCTGAGTGAGG - Intronic
921758047 1:218882044-218882066 TGTGCTGGGCCCACAGGGTGAGG - Intergenic
922764905 1:228151664-228151686 GCAGTAGGCCCCACTGGGTGTGG - Intronic
1062799794 10:370462-370484 TGGGGTGGGCACACTGGGTGGGG - Intronic
1064688549 10:17890437-17890459 TCTGATAGGCTCACTGGGTGTGG - Intronic
1067497428 10:46773471-46773493 TGTGCTGGCTCCACTGGGCGGGG - Intergenic
1067597224 10:47566944-47566966 TGTGCTGGCTCCACTGGGCGGGG + Intergenic
1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG + Intronic
1069707392 10:70467388-70467410 TCTGGTGGTCCCAGTGGTGGAGG + Intergenic
1069982027 10:72259396-72259418 TCTGGTGCTCCCACTGGGATAGG - Intergenic
1070140573 10:73734554-73734576 TGTGCTGGCTCCACTGGGCGGGG + Intergenic
1070510679 10:77157944-77157966 TCTGGTGCCCCCATGGGTTGGGG + Intronic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1072921199 10:99578736-99578758 TCTGGGGGCACCACGGGGAGGGG - Intergenic
1075029049 10:119008882-119008904 TTTGGTGGCCACACTGTGGGGGG + Intergenic
1075211025 10:120491123-120491145 GCTGCTGGCCCTGCTGGGTGAGG + Intronic
1075685978 10:124365409-124365431 TCTGTTGGCCCCACTGCGGGTGG - Intergenic
1075705246 10:124496749-124496771 TGCGCTCGCCCCACTGGGTGTGG + Intronic
1075779972 10:125011143-125011165 TCTGGGGAGCCCACTTGGTGTGG - Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077061259 11:618846-618868 TGCTGTGCCCCCACTGGGTGTGG + Exonic
1077231511 11:1459962-1459984 GCTGCTGGCCCCACTGCATGAGG - Intronic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1077901664 11:6494978-6495000 TCTGGTGGCTCTAGGGGGTGGGG - Intronic
1078386765 11:10899359-10899381 TCTGGTGGGCCAGCTGGGCGTGG + Intergenic
1079837283 11:25350549-25350571 TCTGCTGTCCCAACAGGGTGGGG + Intergenic
1079945973 11:26741115-26741137 TCTGGAGGCCCCCCTGAGTGAGG - Intergenic
1080577085 11:33609697-33609719 CCTGCCGGCCCCACTGGGTCAGG + Intronic
1081607752 11:44537814-44537836 TCTGTCTTCCCCACTGGGTGTGG + Intergenic
1082782379 11:57297849-57297871 ACTGGTGGCCCCACTGGTCTGGG - Intergenic
1083655448 11:64227000-64227022 TCTGGCGGACCCACTGGGGGTGG + Exonic
1084088704 11:66866425-66866447 TGTGGACGCCCCACTGGCTGCGG - Intronic
1084288215 11:68145580-68145602 CCTGGCTGCCCCACTGGGGGTGG + Intergenic
1089117929 11:116111369-116111391 TCTGCTGACTCCACTGGGAGAGG + Intergenic
1089467695 11:118696106-118696128 TCAGGTGGTCCCAGGGGGTGGGG - Intergenic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1091917369 12:4279452-4279474 GCTGTTTGCCCCACTGGGCGCGG + Intronic
1093528796 12:20136224-20136246 TCAGGAGGTCCCACTGAGTGGGG + Intergenic
1094458652 12:30668728-30668750 TATGGGGGCCCTACTGTGTGTGG - Intronic
1097599721 12:61675879-61675901 ACTGTTGGCCCCAGGGGGTGCGG + Intergenic
1099167912 12:79329167-79329189 TCTGAAAGACCCACTGGGTGAGG + Intronic
1099983883 12:89640402-89640424 TTTGGTTGCCTCACTGGGGGTGG + Intronic
1101051512 12:100868646-100868668 TGTGGTGGCTGCCCTGGGTGTGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1114219350 14:20682991-20683013 GCTGTTGGCCTCACTGGGCGCGG - Intergenic
1114568523 14:23649545-23649567 TCTCGTGGCCTAACTGGGTAGGG + Intergenic
1118013140 14:61630460-61630482 TCAGGTGGCCCCACAGAGGGAGG - Intronic
1120195403 14:81476991-81477013 TCTGGTGGCCCCTCCTGCTGGGG + Exonic
1121104896 14:91273405-91273427 TCTCGGGGCCACGCTGGGTGGGG + Exonic
1121614214 14:95301970-95301992 TGTGGTGGCCCAACTGAATGAGG - Intronic
1122046821 14:99029869-99029891 TCGGGTGGTACCACTGTGTGTGG + Intergenic
1122290324 14:100677414-100677436 TCTTGCCGCCCCACTGGGTGAGG + Intergenic
1122325634 14:100879473-100879495 CCTGGTGGCCTCAGTGGGGGTGG + Intergenic
1126174515 15:45723033-45723055 TCTGGTGGCCACATCTGGTGAGG - Intergenic
1126375172 15:47990392-47990414 TCTGGTGGCACTACTGGGTGTGG - Intergenic
1128063537 15:64750098-64750120 TCTGGGAGCCCCGCTGGCTGAGG - Intronic
1128804215 15:70518589-70518611 TCTGTTGGCTCCTTTGGGTGTGG - Intergenic
1130032291 15:80326970-80326992 TCTGGAGGCCCCACGGGTTTGGG + Intergenic
1131303905 15:91224329-91224351 TCTGGTAGCCTCAATGTGTGAGG + Intronic
1132220407 15:100100951-100100973 TCTGGTTGCCCACCTGGCTGAGG - Intronic
1132462001 16:60132-60154 TCTGGTATCACCAGTGGGTGGGG + Intronic
1133030827 16:3010218-3010240 CCTGGTGGCCCCACAGAGTCTGG - Intergenic
1133079192 16:3305277-3305299 TCTCGTGTCCCCAGTGGGGGAGG - Exonic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1138114966 16:54353113-54353135 TCTGGTGGGCATATTGGGTGTGG + Intergenic
1138652112 16:58466516-58466538 TCTGGTGACCCCATCTGGTGGGG - Intronic
1140060794 16:71568048-71568070 TCAGGTGGCCCTACTGGGAGAGG - Exonic
1140891066 16:79285624-79285646 TCTGGTGGCCTCCAGGGGTGGGG + Intergenic
1141082192 16:81062006-81062028 TCTGGAGGCTCCAGTGGGAGAGG + Exonic
1141204702 16:81924837-81924859 TGTGGTTGCCCAACTGGGTCTGG - Intronic
1141521912 16:84586100-84586122 TATGGTGGTCCCTCTGGGTCAGG - Intronic
1141545091 16:84761521-84761543 CCTTGTGGCCCCACTGGGAGAGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1143762794 17:9117029-9117051 TGGGATGGCCCCACTGGGCGGGG + Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1149242632 17:54668253-54668275 TCTGATGGCTCCACTGGGGATGG - Intergenic
1149576181 17:57715286-57715308 CCTGGTGGCCCCTCTCTGTGTGG - Intergenic
1150809950 17:68348394-68348416 TCTGGTGTCTCCTGTGGGTGTGG + Intronic
1151513595 17:74578069-74578091 TGGGGTGTCCACACTGGGTGGGG + Intergenic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1155793575 18:30005271-30005293 TCAGCTGGCCCCAAGGGGTGGGG + Intergenic
1155982515 18:32196084-32196106 TCTGGTGCCCCCGCTGGCTCGGG + Intronic
1160331635 18:77998213-77998235 TCTGGTGGCCACACTTTCTGCGG - Intergenic
1161353261 19:3805260-3805282 ACTGCTGGCCCCCCTGGCTGTGG + Exonic
1161612215 19:5249638-5249660 TTTGGTGTCCCCAGTGGGTCAGG - Intronic
1162783667 19:13020889-13020911 TCTGGTGGTACAACTGGGTCAGG - Intronic
1163374802 19:16923419-16923441 TCTGAGGGCACCACTGTGTGTGG + Intronic
1163425815 19:17240534-17240556 TCTGGGTGCCTCACAGGGTGGGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1163550152 19:17962069-17962091 TCGGTTGGACCCACTGGATGTGG + Intronic
1163632344 19:18423944-18423966 TCTGGGGGCGCCACCGGTTGGGG - Intronic
1163697595 19:18771863-18771885 TCTGGGTGACACACTGGGTGTGG - Intronic
1163963098 19:20716163-20716185 TCTGGTGGTGGCAGTGGGTGGGG - Intronic
1165114582 19:33521484-33521506 TCTGGCGGCCCCACCGTGTGCGG - Intronic
1165767485 19:38360392-38360414 TGTGGTGGCCCCATTGTTTGAGG - Intronic
1165804439 19:38572088-38572110 TCTGGTGGCAGCTCTGGCTGGGG + Exonic
1166772912 19:45295011-45295033 GCAGGTGTTCCCACTGGGTGTGG + Intronic
1168688914 19:58365257-58365279 TCTGAAGGCCCCACTGGGCTTGG - Intergenic
925169224 2:1740703-1740725 TCTGGGGGCCCCACTGGACTGGG + Intronic
925436676 2:3844310-3844332 TCAGGTGGCCGCTCTGGGTGTGG - Intronic
926421441 2:12703747-12703769 AATAGTGGCCCCACAGGGTGGGG - Intergenic
927192092 2:20523924-20523946 TCTCCTGGCCCCAGTGGGTCTGG - Intergenic
929747238 2:44671573-44671595 TGGGGTGGCCACACGGGGTGAGG - Intronic
941844623 2:170120797-170120819 GCTGCTGGCCCCACAGAGTGTGG - Intergenic
942386962 2:175452665-175452687 TCTGGTGGCAGCTCTTGGTGAGG + Intergenic
944724769 2:202459502-202459524 TTTGCTGGCCCCAGTGTGTGGGG + Intronic
946516008 2:220412295-220412317 TCTGGTGGCTTCAGTGGGTGGGG + Intergenic
947500106 2:230665365-230665387 TCTGGTGGCAACACGTGGTGTGG - Intergenic
947613133 2:231536181-231536203 TGTGGATGACCCACTGGGTGGGG - Intergenic
948583329 2:239003047-239003069 TCTGCCAGCCCCACAGGGTGGGG - Intergenic
949017829 2:241723431-241723453 GCTGGTGGCTGCTCTGGGTGTGG + Intronic
1170769924 20:19323633-19323655 CCTGGTGAACCCACTGGATGTGG - Intronic
1172056037 20:32155030-32155052 TCTGGGGGCCCCACCGGGACAGG + Intronic
1172124453 20:32617019-32617041 TTTGGTGTCACCACTGGGAGTGG - Intergenic
1173354047 20:42270333-42270355 CCTGGAGGACCCACTGAGTGTGG + Intronic
1173426290 20:42946308-42946330 TCTGGTGTCCTCAATGGGTCTGG - Intronic
1173662228 20:44742715-44742737 TCAGGTGTGCCCACTGGGGGTGG - Intergenic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1174932309 20:54829293-54829315 TCTGCAAGCCCCACTGGGTCAGG - Intergenic
1175755573 20:61527719-61527741 CCTGGTGTCCCCAGTGAGTGAGG + Intronic
1175799991 20:61796115-61796137 GCCAGTGGCCCCACAGGGTGAGG - Intronic
1175978453 20:62725341-62725363 GCTGGAGGCCCCACAGGATGAGG - Intronic
1179552845 21:42154429-42154451 ACTGGTGACCCCACTGCGAGGGG - Intergenic
1179553099 21:42155720-42155742 ACTGGTGACCCCACTGCGAGAGG + Intergenic
1180932965 22:19605944-19605966 TGTGGTGGCCCCACAGGCAGCGG + Intergenic
1184214808 22:43059611-43059633 TCTGGAGTGCCCCCTGGGTGTGG + Intronic
1184252303 22:43267785-43267807 TCAGATGGCCCCTCTGGGAGAGG - Intronic
954529161 3:51303727-51303749 TCAGGTGACACCTCTGGGTGTGG - Intronic
956222539 3:66919765-66919787 TGTGGTGGGGTCACTGGGTGGGG + Intergenic
961332031 3:126148060-126148082 ACTGGTGGCCCCAAGCGGTGTGG - Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961388326 3:126537029-126537051 ACTGGTGGCTCCACTAGGGGAGG - Intronic
962811014 3:138959653-138959675 TCAGGTTGCCCCACTGGGCATGG + Intergenic
964386415 3:156152465-156152487 TCTGGTGAACCCACTGTGGGAGG + Intronic
967190105 3:186977540-186977562 TCTCCTGGGCCCACTGGGTCAGG + Intronic
968476264 4:810537-810559 TCTGGTCACCCTAGTGGGTGTGG + Intronic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
969866660 4:10080755-10080777 GCAGGTGGCCCCACTGTCTGGGG + Intronic
979688495 4:123537708-123537730 TCTCATGGCCCCAAAGGGTGAGG - Intergenic
981176388 4:141688827-141688849 ACTAGTGGCCCCACTGTGTCCGG + Intronic
983957603 4:173715983-173716005 TGGGGCGGCCCCACTTGGTGAGG - Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
985789210 5:1916260-1916282 CCTGGTGGCCCCACATGGTACGG - Intergenic
985862988 5:2488808-2488830 TCTGGAGACACCTCTGGGTGCGG - Intergenic
985919248 5:2956834-2956856 TGTGATGGCTCCACTGGTTGTGG + Intergenic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
993794325 5:92248707-92248729 TATGAAGGCCCCACTGGGGGTGG - Intergenic
995540672 5:113183125-113183147 TCTGGAGCCCCCACTGCGTGAGG - Intronic
997209549 5:132069417-132069439 TCTGGTGGTCCCATGGGGTGGGG - Intergenic
997365880 5:133324923-133324945 TGGGTTGTCCCCACTGGGTGAGG - Intronic
998177279 5:139909656-139909678 TCTGGCAGCCTCACTGAGTGAGG - Intronic
998527990 5:142860032-142860054 TCTGGTGGACCCACCATGTGTGG - Intronic
999122596 5:149220608-149220630 CCTGGTGTCCCCACTTGGTGAGG - Intronic
999373245 5:151068959-151068981 TGTGGAGGCCCCGCTGGCTGAGG - Intronic
999429306 5:151512228-151512250 TGTGGAGGCAGCACTGGGTGAGG + Exonic
1001819458 5:174698618-174698640 TCTGCTGGCCTCTCTAGGTGGGG + Intergenic
1005303237 6:24491182-24491204 TCTGGTGGCCAGAAGGGGTGTGG - Intronic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006809300 6:36809779-36809801 GCTGGGAGCCCCACTGGCTGGGG - Intronic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1008231285 6:48987176-48987198 CCTGGTAGCTCCACTGGGTGTGG + Intergenic
1008503833 6:52209594-52209616 TCTGTGGGCCACACTGGGAGAGG + Intergenic
1018984132 6:168623003-168623025 TCTGGAAGCCCCTCTGGGTAGGG + Intronic
1019210075 6:170397803-170397825 GCTGTTGGCCCCTCTAGGTGAGG + Intronic
1019324849 7:432997-433019 TCTGGTGGCCCTGCAGGGAGGGG - Intergenic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019623460 7:2003622-2003644 TCCGGTGGCCCCACTGAGTGAGG - Intronic
1020948306 7:14643733-14643755 TGTGGTGGCCCCACTGCTAGAGG - Intronic
1021125868 7:16850938-16850960 CCTGGTGCCCCCACTGAGGGAGG + Intergenic
1022192065 7:28026130-28026152 TCTAGAGGCCCCACTGGGTCTGG + Intronic
1024173987 7:46819470-46819492 TCTGTTGACACCAGTGGGTGAGG - Intergenic
1024574598 7:50753651-50753673 TGTGGTGGCTCCATTTGGTGGGG - Intronic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1030643982 7:112038572-112038594 TCTTGTGCCACCACTGGCTGTGG + Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1034255955 7:149724790-149724812 TCTGGTGTCTCCAGTGGCTGAGG - Exonic
1034260161 7:149750242-149750264 TCTTGTGGCCCAACTGGATCTGG - Intergenic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1039777402 8:40750745-40750767 TCTGATGGCCCACCTGGGTGTGG - Intronic
1040318378 8:46276760-46276782 TCTGGAGCACCCCCTGGGTGGGG - Intergenic
1044392130 8:91663582-91663604 TCAGGTGGCAGCACTGAGTGTGG + Intergenic
1045253804 8:100502759-100502781 TCTGGTGTCACCGCAGGGTGTGG + Intergenic
1048295200 8:133208981-133209003 TCTGTTGGCCTCACTAGGTGGGG + Intronic
1049314101 8:141950552-141950574 TGTGGTGGTGCCACTGAGTGAGG + Intergenic
1049329190 8:142041031-142041053 TCAGGTGGAGCCAATGGGTGTGG - Intergenic
1049530568 8:143152382-143152404 TTTGGAGGCCCCACTGGGGAAGG + Intergenic
1053121160 9:35548267-35548289 TCGGGGGGCCCCACTGGATGAGG + Exonic
1053243841 9:36518471-36518493 TATGTTGGCCACACTGGGTCTGG + Intergenic
1056710141 9:88985827-88985849 GCAGGTGGCCCCATTGAGTGTGG - Intergenic
1060773385 9:126349018-126349040 CCAGGTGGCCCTACAGGGTGTGG - Intronic
1060822205 9:126668006-126668028 TGATGTGGTCCCACTGGGTGTGG + Intronic
1062204075 9:135326142-135326164 CCTTGTGGCCCCCCTGCGTGTGG + Intergenic
1062204946 9:135331182-135331204 TCTGGTAGCCCCACTTGGGTGGG - Intergenic
1062542260 9:137046685-137046707 CCTGGTGGCCTCACTGAGCGCGG - Intergenic
1062555560 9:137112146-137112168 TGTGCTGACCCCACTGGCTGCGG - Exonic
1062577558 9:137215665-137215687 TCCGGGTGCCCCTCTGGGTGCGG + Exonic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1189204971 X:39230042-39230064 TCTGTCGACCCCACTGGTTGAGG + Intergenic
1190077799 X:47331033-47331055 TCTGGTGGCTAGGCTGGGTGTGG - Intergenic
1194195322 X:90884340-90884362 TCTGGTGGCCCCAGTTGGGTGGG + Intergenic
1194263990 X:91733517-91733539 TAGGGTGGCCCCACCTGGTGAGG + Intergenic
1195223577 X:102769349-102769371 TCTTCTGGCCCCAGTGAGTGTGG + Intergenic
1199847618 X:151702437-151702459 GCTGGTGGCCTCACTGGGGTAGG - Exonic
1201748749 Y:17409432-17409454 TCTGGGGCCCCCACTGTCTGTGG + Intergenic