ID: 1102646799

View in Genome Browser
Species Human (GRCh38)
Location 12:114409014-114409036
Sequence TCTCCGCCAAGGGGTCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102646785_1102646799 22 Left 1102646785 12:114408969-114408991 CCCAGCACAGAGCCGGAGAGCGT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1102646784_1102646799 26 Left 1102646784 12:114408965-114408987 CCTGCCCAGCACAGAGCCGGAGA 0: 1
1: 0
2: 2
3: 29
4: 278
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1102646786_1102646799 21 Left 1102646786 12:114408970-114408992 CCAGCACAGAGCCGGAGAGCGTC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1102646794_1102646799 -9 Left 1102646794 12:114409000-114409022 CCGGAAGGGTAAGTTCTCCGCCA 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1102646793_1102646799 -5 Left 1102646793 12:114408996-114409018 CCTTCCGGAAGGGTAAGTTCTCC 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1102646789_1102646799 10 Left 1102646789 12:114408981-114409003 CCGGAGAGCGTCGGGCCTTCCGG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102646799 Original CRISPR TCTCCGCCAAGGGGTCCCGA GGG Intergenic