ID: 1102650638

View in Genome Browser
Species Human (GRCh38)
Location 12:114439877-114439899
Sequence TAGGGAAGTTCAGGGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102650638_1102650643 0 Left 1102650638 12:114439877-114439899 CCAGCTCTCCCTGAACTTCCCTA No data
Right 1102650643 12:114439900-114439922 AGCTGCTACAAATAATCGCGTGG No data
1102650638_1102650644 7 Left 1102650638 12:114439877-114439899 CCAGCTCTCCCTGAACTTCCCTA No data
Right 1102650644 12:114439907-114439929 ACAAATAATCGCGTGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102650638 Original CRISPR TAGGGAAGTTCAGGGAGAGC TGG (reversed) Intergenic
No off target data available for this crispr