ID: 1102650779

View in Genome Browser
Species Human (GRCh38)
Location 12:114440872-114440894
Sequence CACGGAAAGCAGAAGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102650765_1102650779 22 Left 1102650765 12:114440827-114440849 CCAGCCATGCCTTCTCCCTGCGG No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650767_1102650779 18 Left 1102650767 12:114440831-114440853 CCATGCCTTCTCCCTGCGGAAAC No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650769_1102650779 7 Left 1102650769 12:114440842-114440864 CCCTGCGGAAACCGCCTGCTCCC No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650770_1102650779 6 Left 1102650770 12:114440843-114440865 CCTGCGGAAACCGCCTGCTCCCT No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650773_1102650779 -7 Left 1102650773 12:114440856-114440878 CCTGCTCCCTGCGCCGCACGGAA No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650771_1102650779 -4 Left 1102650771 12:114440853-114440875 CCGCCTGCTCCCTGCGCCGCACG No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data
1102650768_1102650779 13 Left 1102650768 12:114440836-114440858 CCTTCTCCCTGCGGAAACCGCCT No data
Right 1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102650779 Original CRISPR CACGGAAAGCAGAAGGCGGA AGG Intergenic
No off target data available for this crispr