ID: 1102651215

View in Genome Browser
Species Human (GRCh38)
Location 12:114443914-114443936
Sequence TGGCGCTGATGAGCGCTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102651211_1102651215 6 Left 1102651211 12:114443885-114443907 CCGCGCGCACCCAGAAACGATGA No data
Right 1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG No data
1102651214_1102651215 -4 Left 1102651214 12:114443895-114443917 CCAGAAACGATGACATAAGTGGC No data
Right 1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG No data
1102651212_1102651215 -3 Left 1102651212 12:114443894-114443916 CCCAGAAACGATGACATAAGTGG No data
Right 1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG No data
1102651210_1102651215 7 Left 1102651210 12:114443884-114443906 CCCGCGCGCACCCAGAAACGATG No data
Right 1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102651215 Original CRISPR TGGCGCTGATGAGCGCTGCG CGG Intergenic
No off target data available for this crispr