ID: 1102659008

View in Genome Browser
Species Human (GRCh38)
Location 12:114508750-114508772
Sequence GACATTTTTCACCATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102659004_1102659008 11 Left 1102659004 12:114508716-114508738 CCTCTAGCGGCCGAGTCTTGGCT No data
Right 1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG No data
1102659006_1102659008 1 Left 1102659006 12:114508726-114508748 CCGAGTCTTGGCTGGACATTAAA No data
Right 1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG No data
1102659003_1102659008 12 Left 1102659003 12:114508715-114508737 CCCTCTAGCGGCCGAGTCTTGGC No data
Right 1102659008 12:114508750-114508772 GACATTTTTCACCATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102659008 Original CRISPR GACATTTTTCACCATGAGCT GGG Intergenic
No off target data available for this crispr