ID: 1102659405

View in Genome Browser
Species Human (GRCh38)
Location 12:114512903-114512925
Sequence CCTTTTATGAAGGGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102659405_1102659414 -5 Left 1102659405 12:114512903-114512925 CCTACTTCCCCCTTCATAAAAGG No data
Right 1102659414 12:114512921-114512943 AAAGGGAGACAGCACCAGTGGGG No data
1102659405_1102659412 -7 Left 1102659405 12:114512903-114512925 CCTACTTCCCCCTTCATAAAAGG No data
Right 1102659412 12:114512919-114512941 TAAAAGGGAGACAGCACCAGTGG No data
1102659405_1102659418 29 Left 1102659405 12:114512903-114512925 CCTACTTCCCCCTTCATAAAAGG No data
Right 1102659418 12:114512955-114512977 TGATAAAAGCTAATATTTTTAGG No data
1102659405_1102659413 -6 Left 1102659405 12:114512903-114512925 CCTACTTCCCCCTTCATAAAAGG No data
Right 1102659413 12:114512920-114512942 AAAAGGGAGACAGCACCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102659405 Original CRISPR CCTTTTATGAAGGGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr