ID: 1102665239

View in Genome Browser
Species Human (GRCh38)
Location 12:114566368-114566390
Sequence TTCCCCTGGGAAGATGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102665234_1102665239 9 Left 1102665234 12:114566336-114566358 CCTTTTACATCATGTATGCAGAC No data
Right 1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG No data
1102665232_1102665239 18 Left 1102665232 12:114566327-114566349 CCCTGGTCACCTTTTACATCATG No data
Right 1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG No data
1102665233_1102665239 17 Left 1102665233 12:114566328-114566350 CCTGGTCACCTTTTACATCATGT No data
Right 1102665239 12:114566368-114566390 TTCCCCTGGGAAGATGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102665239 Original CRISPR TTCCCCTGGGAAGATGCTGA GGG Intergenic
No off target data available for this crispr