ID: 1102666669

View in Genome Browser
Species Human (GRCh38)
Location 12:114580072-114580094
Sequence CTGTGGGAGGCGAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102666662_1102666669 -8 Left 1102666662 12:114580057-114580079 CCTATAATCTCAGCACTGTGGGA 0: 26
1: 2552
2: 51497
3: 345653
4: 239152
Right 1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102666669 Original CRISPR CTGTGGGAGGCGAAGGTGGG GGG Intergenic
No off target data available for this crispr