ID: 1102672369

View in Genome Browser
Species Human (GRCh38)
Location 12:114631001-114631023
Sequence CAGGATAATTAGATCTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102672369_1102672372 -4 Left 1102672369 12:114631001-114631023 CCAGGCTAGATCTAATTATCCTG No data
Right 1102672372 12:114631020-114631042 CCTGAAGGTGTCCTGAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102672369 Original CRISPR CAGGATAATTAGATCTAGCC TGG (reversed) Intergenic
No off target data available for this crispr