ID: 1102676500

View in Genome Browser
Species Human (GRCh38)
Location 12:114663149-114663171
Sequence GATGATGAGGCCAATGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676500_1102676508 12 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676500_1102676506 3 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676506 12:114663175-114663197 ACTTTTGTGATTTGCCTTGAAGG No data
1102676500_1102676513 28 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676513 12:114663200-114663222 AGTATGGGGTAGAATAGAGGTGG No data
1102676500_1102676514 29 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676514 12:114663201-114663223 GTATGGGGTAGAATAGAGGTGGG No data
1102676500_1102676509 13 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676509 12:114663185-114663207 TTTGCCTTGAAGGGAAGTATGGG No data
1102676500_1102676512 25 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676512 12:114663197-114663219 GGAAGTATGGGGTAGAATAGAGG No data
1102676500_1102676510 14 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676510 12:114663186-114663208 TTGCCTTGAAGGGAAGTATGGGG No data
1102676500_1102676507 4 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676507 12:114663176-114663198 CTTTTGTGATTTGCCTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676500 Original CRISPR GATGATGAGGCCAATGTTGG GGG (reversed) Intergenic
No off target data available for this crispr