ID: 1102676503

View in Genome Browser
Species Human (GRCh38)
Location 12:114663152-114663174
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676503_1102676507 1 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676507 12:114663176-114663198 CTTTTGTGATTTGCCTTGAAGGG No data
1102676503_1102676506 0 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676506 12:114663175-114663197 ACTTTTGTGATTTGCCTTGAAGG No data
1102676503_1102676508 9 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676503_1102676512 22 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676512 12:114663197-114663219 GGAAGTATGGGGTAGAATAGAGG No data
1102676503_1102676515 30 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676503_1102676514 26 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676514 12:114663201-114663223 GTATGGGGTAGAATAGAGGTGGG No data
1102676503_1102676513 25 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676513 12:114663200-114663222 AGTATGGGGTAGAATAGAGGTGG No data
1102676503_1102676509 10 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676509 12:114663185-114663207 TTTGCCTTGAAGGGAAGTATGGG No data
1102676503_1102676510 11 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676510 12:114663186-114663208 TTGCCTTGAAGGGAAGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676503 Original CRISPR ATGGATGATGAGGCCAATGT TGG (reversed) Intergenic