ID: 1102676504

View in Genome Browser
Species Human (GRCh38)
Location 12:114663162-114663184
Sequence TCACAAAAGTATGGATGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676504_1102676509 0 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676509 12:114663185-114663207 TTTGCCTTGAAGGGAAGTATGGG No data
1102676504_1102676513 15 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676513 12:114663200-114663222 AGTATGGGGTAGAATAGAGGTGG No data
1102676504_1102676515 20 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676504_1102676507 -9 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676507 12:114663176-114663198 CTTTTGTGATTTGCCTTGAAGGG No data
1102676504_1102676516 21 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676516 12:114663206-114663228 GGGTAGAATAGAGGTGGGCAGGG No data
1102676504_1102676510 1 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676510 12:114663186-114663208 TTGCCTTGAAGGGAAGTATGGGG No data
1102676504_1102676518 23 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676518 12:114663208-114663230 GTAGAATAGAGGTGGGCAGGGGG No data
1102676504_1102676514 16 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676514 12:114663201-114663223 GTATGGGGTAGAATAGAGGTGGG No data
1102676504_1102676508 -1 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676504_1102676506 -10 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676506 12:114663175-114663197 ACTTTTGTGATTTGCCTTGAAGG No data
1102676504_1102676512 12 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676512 12:114663197-114663219 GGAAGTATGGGGTAGAATAGAGG No data
1102676504_1102676517 22 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676517 12:114663207-114663229 GGTAGAATAGAGGTGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676504 Original CRISPR TCACAAAAGTATGGATGATG AGG (reversed) Intergenic
No off target data available for this crispr