ID: 1102676505

View in Genome Browser
Species Human (GRCh38)
Location 12:114663171-114663193
Sequence CAAGGCAAATCACAAAAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676505_1102676514 7 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676514 12:114663201-114663223 GTATGGGGTAGAATAGAGGTGGG No data
1102676505_1102676509 -9 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676509 12:114663185-114663207 TTTGCCTTGAAGGGAAGTATGGG No data
1102676505_1102676512 3 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676512 12:114663197-114663219 GGAAGTATGGGGTAGAATAGAGG No data
1102676505_1102676515 11 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676505_1102676513 6 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676513 12:114663200-114663222 AGTATGGGGTAGAATAGAGGTGG No data
1102676505_1102676510 -8 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676510 12:114663186-114663208 TTGCCTTGAAGGGAAGTATGGGG No data
1102676505_1102676516 12 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676516 12:114663206-114663228 GGGTAGAATAGAGGTGGGCAGGG No data
1102676505_1102676518 14 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676518 12:114663208-114663230 GTAGAATAGAGGTGGGCAGGGGG No data
1102676505_1102676508 -10 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676505_1102676517 13 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676517 12:114663207-114663229 GGTAGAATAGAGGTGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676505 Original CRISPR CAAGGCAAATCACAAAAGTA TGG (reversed) Intergenic
No off target data available for this crispr