ID: 1102676508

View in Genome Browser
Species Human (GRCh38)
Location 12:114663184-114663206
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676502_1102676508 10 Left 1102676502 12:114663151-114663173 CCCAACATTGGCCTCATCATCCA No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676505_1102676508 -10 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676504_1102676508 -1 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676501_1102676508 11 Left 1102676501 12:114663150-114663172 CCCCAACATTGGCCTCATCATCC No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676503_1102676508 9 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data
1102676500_1102676508 12 Left 1102676500 12:114663149-114663171 CCCCCAACATTGGCCTCATCATC No data
Right 1102676508 12:114663184-114663206 ATTTGCCTTGAAGGGAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676508 Original CRISPR ATTTGCCTTGAAGGGAAGTA TGG Intergenic
No off target data available for this crispr