ID: 1102676515

View in Genome Browser
Species Human (GRCh38)
Location 12:114663205-114663227
Sequence GGGGTAGAATAGAGGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102676505_1102676515 11 Left 1102676505 12:114663171-114663193 CCATACTTTTGTGATTTGCCTTG No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676511_1102676515 -7 Left 1102676511 12:114663189-114663211 CCTTGAAGGGAAGTATGGGGTAG No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676504_1102676515 20 Left 1102676504 12:114663162-114663184 CCTCATCATCCATACTTTTGTGA No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data
1102676503_1102676515 30 Left 1102676503 12:114663152-114663174 CCAACATTGGCCTCATCATCCAT No data
Right 1102676515 12:114663205-114663227 GGGGTAGAATAGAGGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102676515 Original CRISPR GGGGTAGAATAGAGGTGGGC AGG Intergenic