ID: 1102677080

View in Genome Browser
Species Human (GRCh38)
Location 12:114666116-114666138
Sequence TGAACCGCGAGGGAAACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102677080_1102677087 20 Left 1102677080 12:114666116-114666138 CCCGCGGTTTCCCTCGCGGTTCA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1102677087 12:114666159-114666181 CAGCTTCAGTGCCCCGCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102677080 Original CRISPR TGAACCGCGAGGGAAACCGC GGG (reversed) Intergenic
901534225 1:9872041-9872063 TGAACCGCGAGGGAGCTCCCGGG - Exonic
915916122 1:159941992-159942014 TGAATCCTGAGGGAAACCCCGGG - Intronic
1069932430 10:71891740-71891762 TGAACAGCCAGGGAGACAGCAGG - Intergenic
1070768550 10:79069716-79069738 GGAACCGCTGGGGAAAGCGCTGG + Intronic
1075661067 10:124196882-124196904 TGAACAGCCAAGGAAACCACAGG + Intergenic
1080315146 11:30939000-30939022 TATCCCGCGAGGGAAACAGCTGG - Intronic
1081492952 11:43581290-43581312 TGAGCCGCGATGGAACGCGCTGG + Intronic
1083571760 11:63765042-63765064 TGACCCGCGGGGGAACCGGCTGG - Exonic
1084483472 11:69435009-69435031 TGAACCTGGAGGGAACCAGCAGG - Intergenic
1088494323 11:110418419-110418441 TGAACCAGGATGGAAAACGCAGG + Intergenic
1102677080 12:114666116-114666138 TGAACCGCGAGGGAAACCGCGGG - Intergenic
1131255716 15:90860650-90860672 TGACCAGCCAGGGACACCGCAGG + Intergenic
1133274140 16:4626324-4626346 GGAACCTCTAGGGAAACCCCAGG - Intronic
1140743366 16:77961124-77961146 TTAACCTTGAGGGAAACAGCTGG + Intronic
1141675011 16:85513244-85513266 TGAGCCGGGAGGGAAAACCCAGG - Intergenic
1149567507 17:57650499-57650521 TGAACCGAGAGGGAGACCAAGGG - Intronic
1150645845 17:66977001-66977023 GGAACCCCGAGGGATACTGCAGG - Intronic
1156348804 18:36284768-36284790 TGAAAAGCGAGGAAAACCACAGG + Intergenic
1161112842 19:2479403-2479425 TGAACCAACAGGGAAACCCCGGG + Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
943704415 2:191020320-191020342 TGAACCGCTTCGGAAACAGCTGG + Intronic
945072285 2:206004121-206004143 TGAACCACTAAGGAAACCACTGG + Exonic
948670940 2:239568217-239568239 TGAACCTGGAGTTAAACCGCAGG + Intergenic
960466018 3:117997336-117997358 AGAACCCAGAGGGAAACCGAGGG - Intergenic
975834643 4:78409469-78409491 AGAACCGCAAGGGAAACCTAAGG + Intronic
984801550 4:183721506-183721528 CAAAGCGCGAGGGAAGCCGCTGG - Intergenic
985320324 4:188703379-188703401 TCAATCGCCAGGGAAACAGCAGG + Intergenic
988926405 5:35994980-35995002 TGAACCAGGATGGAAAACGCAGG + Intergenic
1007506235 6:42337411-42337433 TGAACCCAGAGAAAAACCGCAGG - Intronic
1010117903 6:72337164-72337186 TGAACCTCCAGGTAAACTGCAGG + Intronic
1011685353 6:89819475-89819497 TGAAGGGAGAGGGAAAGCGCCGG - Intronic
1024688065 7:51769795-51769817 TGCACCGGGAGGGAAGCCGGTGG - Intergenic
1032705192 7:134415184-134415206 TCACCCTCGAGGGAAACTGCAGG - Intergenic
1036127562 8:6076883-6076905 TGAACCGCGCTGGAAGTCGCTGG - Intergenic
1049090801 8:140511990-140512012 GGAAGCGCGAGAGAAACGGCGGG - Intronic
1049809857 8:144561589-144561611 TGGAGCGCGATGGAAACCACTGG - Intronic
1049809866 8:144561629-144561651 TGGAGCGCGATGGAAACCACTGG - Intronic
1049809869 8:144561649-144561671 TGGAGCGCGATGGAAACCACTGG - Intronic
1049809872 8:144561669-144561691 TGGAGCGCGATGGAAACCACTGG - Intronic
1049810003 8:144562369-144562391 TGGAGCGCGATGGAAACCACTGG - Intronic
1049810006 8:144562389-144562411 TGGAGCGCGATGGAAACCACTGG - Intronic