ID: 1102677239

View in Genome Browser
Species Human (GRCh38)
Location 12:114667253-114667275
Sequence GGGGACAGTTCCTGACGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102677239_1102677247 22 Left 1102677239 12:114667253-114667275 CCTACACGTCAGGAACTGTCCCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1102677247 12:114667298-114667320 AACAGCGCAGATCTAGAGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 117
1102677239_1102677241 -7 Left 1102677239 12:114667253-114667275 CCTACACGTCAGGAACTGTCCCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1102677241 12:114667269-114667291 TGTCCCCACAAAGAAAGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 271
1102677239_1102677240 -8 Left 1102677239 12:114667253-114667275 CCTACACGTCAGGAACTGTCCCC 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1102677240 12:114667268-114667290 CTGTCCCCACAAAGAAAGAGTGG 0: 1
1: 0
2: 0
3: 19
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102677239 Original CRISPR GGGGACAGTTCCTGACGTGT AGG (reversed) Intergenic