ID: 1102678082

View in Genome Browser
Species Human (GRCh38)
Location 12:114672075-114672097
Sequence GGCCGCCGCCATGGAGGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102678063_1102678082 29 Left 1102678063 12:114672023-114672045 CCGAGGCCGGGCTGGCGGCCAGG 0: 1
1: 0
2: 2
3: 42
4: 391
Right 1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 188
1102678074_1102678082 -10 Left 1102678074 12:114672062-114672084 CCAGGGGCCCCGCGGCCGCCGCC 0: 1
1: 2
2: 34
3: 242
4: 1348
Right 1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 188
1102678067_1102678082 23 Left 1102678067 12:114672029-114672051 CCGGGCTGGCGGCCAGGGCGGCG 0: 1
1: 0
2: 0
3: 33
4: 434
Right 1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 188
1102678073_1102678082 -6 Left 1102678073 12:114672058-114672080 CCGTCCAGGGGCCCCGCGGCCGC 0: 1
1: 0
2: 2
3: 27
4: 283
Right 1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 188
1102678068_1102678082 11 Left 1102678068 12:114672041-114672063 CCAGGGCGGCGACTTTGCCGTCC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102678082 Original CRISPR GGCCGCCGCCATGGAGGGCA GGG Exonic
900205022 1:1427946-1427968 CGCCCCCGCCACGGAGGGCAGGG + Intergenic
900366791 1:2314861-2314883 GGGCGCCGCCCCGGACGGCAGGG - Intergenic
900488401 1:2934423-2934445 GGCCACCGACGTGGAAGGCAGGG + Intergenic
900550085 1:3250253-3250275 GGCTGCCACCTTGGAGGCCACGG - Intronic
900604222 1:3516641-3516663 GCCCGGCACCATGGAGGGGAGGG + Intronic
902390160 1:16099066-16099088 GGGCGCACCCAGGGAGGGCATGG - Intergenic
903191572 1:21659428-21659450 GGCCGCCTCCATGTAAGGGAGGG - Intronic
903848338 1:26291443-26291465 GGCCTCCAAGATGGAGGGCAGGG + Intronic
904171071 1:28592502-28592524 GGACGCGGCCATGGAGGCCGAGG + Intronic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
916827451 1:168456168-168456190 GGCTGAAGACATGGAGGGCAGGG + Intergenic
917001654 1:170367560-170367582 GGCTGCCTCCAGGGAGGGCAAGG + Intergenic
918154597 1:181832639-181832661 AGCCGCCTCCCTGCAGGGCAGGG + Intergenic
922100557 1:222474335-222474357 GGCCGCCAACAGGGAGGGGATGG + Intergenic
922734073 1:227970341-227970363 GGCCGCCGACAGGCAGGGGATGG - Intergenic
1062951288 10:1505738-1505760 GGCGGCTGCCATGGTGGGGACGG - Intronic
1063655141 10:7980813-7980835 GACAGCCACCATGGAGGCCAGGG + Intronic
1067044473 10:42976482-42976504 GGCTGCCCCCAGGGAAGGCAGGG + Intergenic
1067184150 10:44012890-44012912 GGCCACAGCCATGGAGGACCGGG + Intergenic
1069624723 10:69860697-69860719 GGCCACAGGCAAGGAGGGCATGG - Intronic
1072152817 10:92696717-92696739 GGCCTCCTCCATGGAGGCCAAGG - Intergenic
1074722118 10:116272601-116272623 CGCCGCCGCCACCGAGGGCTCGG - Intronic
1076806658 10:132862326-132862348 GGCCGGCGACAGGGCGGGCAGGG + Intronic
1077134376 11:991274-991296 GTCCCCCTCCATGGATGGCAAGG - Intronic
1077181856 11:1220428-1220450 GGCCGTGGTCAGGGAGGGCAGGG + Intergenic
1077184022 11:1228511-1228533 GGCAGCCCCCATGGATGGCAGGG + Intronic
1077185772 11:1234748-1234770 GGCAGCGGGCAGGGAGGGCAGGG + Intronic
1080834483 11:35927765-35927787 GGCCCCTGCCAAGGAGGGCCGGG - Intergenic
1083448448 11:62726790-62726812 GGCGGCAGCCATGGAGGCCGCGG - Exonic
1083619522 11:64042039-64042061 GGCAGCGGCCATGGTGGGCCAGG + Intronic
1083799134 11:65036156-65036178 GGCCCCCCCAATGGAGGTCAGGG + Intronic
1087007253 11:93482295-93482317 GGCCTGAGCCAGGGAGGGCATGG + Intronic
1090994910 11:131857324-131857346 GGACACAGCCATGGAAGGCAAGG - Intronic
1091401269 12:182170-182192 GGCAGACCCCGTGGAGGGCAAGG + Intergenic
1091568003 12:1662252-1662274 GGCCGCGGCCACAGAGGGCTGGG - Intergenic
1095349390 12:41190049-41190071 GGTCGCTGCCATGGTGAGCAGGG + Intronic
1097916357 12:65024400-65024422 GGCCTCAGCCAGGGTGGGCAGGG - Intergenic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1103622931 12:122200031-122200053 GGCTGCCACCAGGCAGGGCAAGG - Intronic
1106241972 13:27920129-27920151 GGCCGCAGCCATGAACGGCGAGG + Exonic
1110676879 13:78258571-78258593 TGCCTAGGCCATGGAGGGCAGGG - Intergenic
1112692882 13:101916634-101916656 GGCCGCGGCCATGGTGGCCCCGG + Intronic
1113119025 13:106906579-106906601 GTCCGCCGCCATTCAGGGAAGGG + Intergenic
1113376619 13:109770116-109770138 GGCCACCACCATGGAGGGCAGGG + Intronic
1113438714 13:110311946-110311968 AGCTGCCGGCCTGGAGGGCAGGG - Intronic
1113985811 13:114314707-114314729 GGCCGCCGACCTGGCGGGGACGG + Intronic
1120392314 14:83924469-83924491 GGAAGCAGCCATGGTGGGCATGG - Intergenic
1120935454 14:89891784-89891806 GGACGCGGCCATGGAGGCCGAGG + Intronic
1121412837 14:93759853-93759875 GGCCTCTGCCAAGCAGGGCAGGG - Intronic
1122412868 14:101534865-101534887 GGCAGCCACCATGGTCGGCAGGG + Intergenic
1122628923 14:103098659-103098681 GGCCGGCGCCCAGCAGGGCAGGG - Intergenic
1202853963 14_GL000225v1_random:38149-38171 AGCTGCCACCATGGAGGGCCTGG + Intergenic
1202857482 14_GL000225v1_random:59880-59902 AGCTGCCACCATGGAGGGCCTGG + Intergenic
1202857885 14_GL000225v1_random:63128-63150 AGCTGCCACCATGGAGGGCCTGG - Intergenic
1124515114 15:30361222-30361244 GGCAGGCGCCAGGGAGGGGATGG - Intronic
1124727808 15:32169505-32169527 GGCAGGCGCCAGGGAGGGGATGG + Intronic
1128506836 15:68278408-68278430 GGCGGCGGCCATGGAGGGCCTGG + Exonic
1132580041 16:680516-680538 GCGCGGCGCCATGAAGGGCAAGG + Exonic
1132642967 16:986210-986232 GGAGGCCGCCCTGGAGGGCCCGG + Exonic
1132691434 16:1183440-1183462 GGCCGCTGCCATGGAGACAAGGG - Intronic
1132814339 16:1818641-1818663 GGCCGCAGCCATGAAGGGCCCGG + Intronic
1133401480 16:5490557-5490579 GGCCAGCACCATGGAGGGCGGGG - Intergenic
1133659691 16:7904242-7904264 GCCTGCCACCATGTAGGGCATGG + Intergenic
1134056180 16:11171141-11171163 GGCCGCGGCCCTGATGGGCATGG - Intronic
1139966677 16:70749672-70749694 GGCCACCAAGATGGAGGGCAAGG + Intronic
1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG + Intergenic
1141958991 16:87392221-87392243 GGCCGCCGCCATGACGGGCGTGG - Exonic
1142561669 17:813387-813409 GGCCCCCGGCTTGGAGGACAAGG + Intronic
1142742577 17:1939831-1939853 GGCCCCCACCCTGGAGGGCCAGG + Intronic
1144719083 17:17455269-17455291 GGCAGCAGCCATGGAAGGCCAGG - Intergenic
1145236932 17:21214686-21214708 GCCCGCCTCCAAGGAGGGCCCGG - Intergenic
1146485016 17:33235686-33235708 GGCTGCCTCCATGGAGGCCAAGG - Intronic
1146906536 17:36621745-36621767 GGCAGGTGGCATGGAGGGCAAGG + Intergenic
1150357253 17:64497143-64497165 GGCGTCCGCCATGGTGGGCGGGG - Intergenic
1151625480 17:75272888-75272910 GGCTGCCGCTATGGAGAACATGG + Intergenic
1152446322 17:80346681-80346703 GGCAGACGCCATGCAGGGCCCGG + Exonic
1152512452 17:80799710-80799732 GGCGGCCGCCAGGGAGGGGAGGG - Intronic
1152642889 17:81456553-81456575 GGACGCAGCCACGGAGGGCTGGG - Exonic
1153030972 18:712591-712613 GGCCGCGGCCACGGGGCGCAGGG - Intronic
1159040561 18:63319994-63320016 GGCCGCCGGCAGGGAGGGCCCGG + Exonic
1160454792 18:78992804-78992826 TGCCGCCGCCATCGCGGGCTCGG + Exonic
1160533917 18:79581101-79581123 GGCCACCACCGTGGAGGGCTTGG + Intergenic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1160818947 19:1049228-1049250 GGACTCAGCCATGGAGGTCATGG - Intronic
1160846593 19:1168750-1168772 GTCCGGGGCCATGGCGGGCAGGG + Intronic
1160991884 19:1863486-1863508 GGCCGCCGACATGCCGAGCAAGG + Exonic
1161061471 19:2217276-2217298 GGCAGGTGCCATGGAGGACATGG + Intronic
1161087319 19:2341089-2341111 GGCGGCCTCCAGGGAGGGCAGGG - Exonic
1161352077 19:3799133-3799155 CCCAGGCGCCATGGAGGGCAGGG - Intronic
1161580844 19:5080005-5080027 GGCCCCCGCCGTGCAGGACATGG - Intronic
1161680313 19:5676810-5676832 GGCCGCCTGGATGGAGGGGAGGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161767750 19:6216488-6216510 GTCCTCCACCATGGAGCGCAGGG + Exonic
1162123308 19:8485664-8485686 GGGTGCCGGCATGGAGCGCATGG + Exonic
1162123403 19:8486081-8486103 GGCCACCGGCCTGGAGCGCATGG + Exonic
1162909272 19:13840649-13840671 GGGCGCCGCCATGCTGGGCACGG - Intergenic
1164639076 19:29811819-29811841 GGCCGGCGCCGTGGAGGGGCGGG + Intergenic
1164715365 19:30386900-30386922 GGTCGCCGGCATGGACAGCAGGG + Intronic
1166694832 19:44846515-44846537 GGCCCGGGCCATGGAGGGCCCGG - Exonic
1167056062 19:47112337-47112359 GGCGGCCGCCATGTTGGGCCGGG - Intronic
1167376368 19:49114461-49114483 GGCCGCGGCCCGGGTGGGCAGGG - Intronic
1168301507 19:55407577-55407599 GGCCGCAGCCATGGTGAGCACGG - Exonic
1168306841 19:55440527-55440549 TGGAGCCGCCATGGAGGGCGGGG + Intronic
1168316368 19:55486466-55486488 GGCCGCCGCCAGGAGGAGCAGGG - Exonic
1168404192 19:56102425-56102447 GGCGGCCTCCGTGGAGGGGAGGG + Intronic
926080060 2:9977963-9977985 GCCGGCCGCCATGGAGGACGTGG - Intronic
931241867 2:60461261-60461283 GCCCGACGTCATGCAGGGCATGG - Exonic
934566089 2:95342180-95342202 GGGCCCGGCCATGGGGGGCAAGG + Intronic
934978597 2:98822809-98822831 GGCGGGCGCCGTGGAGGGCTCGG + Exonic
935622909 2:105144340-105144362 GGCCACCGCCCGGGAGGGCGCGG + Intergenic
935763771 2:106344556-106344578 GCTCCCTGCCATGGAGGGCATGG + Intergenic
936494289 2:113004685-113004707 GGCCGGGGGCATGGATGGCATGG - Intergenic
936521818 2:113216312-113216334 GGATGCTGCCATGGATGGCATGG - Exonic
937140564 2:119596349-119596371 GACAGCACCCATGGAGGGCAGGG - Intronic
946231318 2:218292594-218292616 GGGCGCCGCCAGGGGGCGCAGGG + Intronic
946327216 2:218990890-218990912 GGCCCAGCCCATGGAGGGCAGGG + Exonic
947739003 2:232476408-232476430 TGCTGCCCCCATGGGGGGCATGG + Intergenic
948289345 2:236813754-236813776 GGCCTCTGGCATGAAGGGCAAGG + Intergenic
948823267 2:240560939-240560961 GTGCGCCGCCATGGAGGCCGCGG + Exonic
1170688203 20:18588063-18588085 AGCCGCCGCCATGAAGGCCGTGG + Exonic
1171123211 20:22582917-22582939 GGCGGCCGGCGTGGCGGGCATGG - Exonic
1171123225 20:22582953-22582975 CGCGGGCGCCATGGCGGGCATGG - Exonic
1171136879 20:22702604-22702626 GGCCACTGCCATGCAGGTCACGG - Intergenic
1171484512 20:25477357-25477379 GGCCGCCACCATGCAGGACCTGG + Intronic
1172771706 20:37386018-37386040 GGCCACAGCCAGGGAAGGCATGG - Intronic
1175223104 20:57428860-57428882 GGCAGCCGACAGGGAGGGCTGGG - Intergenic
1175399956 20:58694363-58694385 GGCCGCCACCAGGGAGTGCAGGG - Intronic
1176005659 20:62861184-62861206 CGGCGCCGCCAAGGAGGGCGCGG - Exonic
1176093050 20:63327432-63327454 GGCAGGCTCCATGGAGGGTAGGG + Intronic
1176232296 20:64038645-64038667 GGCCGCCGCGACGCCGGGCAGGG - Intronic
1179708211 21:43194603-43194625 GGCTGCCGGCATGGAGGTCAAGG - Intergenic
1181171042 22:21010261-21010283 GGCAGCCGGGATGGAGGGCCTGG - Intronic
1181278023 22:21699021-21699043 TGCCGCTGCCCTGGTGGGCATGG - Exonic
1181282250 22:21728245-21728267 GGCCTCCTCCATGGAGAGGAGGG - Intronic
1183063736 22:35350100-35350122 GGCCGGGGGCATGGAGGGGAGGG + Intergenic
1183393549 22:37559687-37559709 GCCCACCTCCATGGAGGGCAGGG - Intergenic
1185345287 22:50308046-50308068 GGACGGCGGCATGGTGGGCAGGG - Intergenic
950724249 3:14906287-14906309 CTCAGCCGCCATGGAGGGGAGGG - Intronic
950729856 3:14947830-14947852 GGCCCCCGGCGCGGAGGGCAGGG - Intronic
950741679 3:15057169-15057191 GGCCCCGGCCAGGGAGAGCACGG - Intronic
953392257 3:42540511-42540533 GACCTCTGCCATGGAGGGGATGG - Intergenic
955195486 3:56801786-56801808 GGCAGCCGCCATGGTGGCCAAGG - Intronic
958814504 3:98901314-98901336 GGCCGCCGCGATGGCGAGCCGGG - Exonic
961447622 3:126988254-126988276 GGCCTCCGCCAGTGATGGCAGGG + Intergenic
961663360 3:128481936-128481958 GGCGGCCGACTGGGAGGGCAAGG + Exonic
961735821 3:129001652-129001674 GGAGGCCGGCATGGAGGGCGCGG + Exonic
962701022 3:137999723-137999745 GGGCGCTGCCATGCAGGGAAAGG + Intronic
967904143 3:194486922-194486944 GGGCGCCGCCGCGGAGGGGAGGG - Intronic
970691974 4:18630707-18630729 GGCCACCTCCCTGCAGGGCAGGG - Intergenic
973636211 4:52863461-52863483 GGGGGGCGCCATGGAGGGCTGGG - Intronic
979259237 4:118633241-118633263 GGCCGCCGACAGGCAGGGGATGG - Intergenic
979329109 4:119407318-119407340 GGCCGCCGACAGGCAGGGAATGG + Intergenic
981128585 4:141133264-141133286 GGCCGCCGCCACTGAGCGCTGGG + Intronic
981280616 4:142954492-142954514 AGCCGCCTCCCTGGGGGGCAGGG + Intergenic
981715465 4:147747513-147747535 GGCCACCTCCATGGCGGTCAGGG - Intronic
985636266 5:1037337-1037359 GAGCGCGGCCAAGGAGGGCAGGG - Intronic
985646251 5:1086032-1086054 TGCAGCAGGCATGGAGGGCATGG + Intronic
986273497 5:6253930-6253952 GGAGGCCGCCATGGAGGTGAAGG - Intergenic
987379857 5:17275360-17275382 CGCCGAGGCCAAGGAGGGCAAGG + Exonic
992027107 5:72681315-72681337 GGCAGCAGCCATGGTAGGCAAGG + Intergenic
997629584 5:135356670-135356692 GGCCCCCACCATTTAGGGCAGGG + Intronic
999392777 5:151206267-151206289 GGTAGCCCCCAAGGAGGGCATGG - Intronic
1000082175 5:157858799-157858821 GGCCGCCGCCATGATGGGGCTGG + Intronic
1004516534 6:16326613-16326635 AGCCGCCGCCGGGGAGGCCACGG + Exonic
1006535593 6:34696591-34696613 GGTCCCCGCCATGGAGGGCATGG - Exonic
1007401004 6:41602279-41602301 GGCAGCCTCCACGGAGGGCTGGG - Exonic
1013793612 6:113860186-113860208 GGCCGCCGCCGAGGCGGGCGCGG + Exonic
1016471129 6:144375734-144375756 GGCAGCCGCCTGGCAGGGCAAGG - Intronic
1017954945 6:159169679-159169701 GGCCGCCGCCGAGGAGGCGACGG - Exonic
1019101173 6:169631503-169631525 GGCTGCCCACAGGGAGGGCACGG + Intronic
1020105705 7:5421357-5421379 GGCCGCCGCCATGCACGCCGCGG - Exonic
1024649181 7:51389911-51389933 GGCCGCCGACAGGCAGGGCCTGG + Intergenic
1027267791 7:76503718-76503740 GGCCAGAGCCATGGAGGGCCGGG + Intronic
1027319603 7:77003580-77003602 GGCCAGGGCCATGGAGGGCTGGG + Intergenic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1032210651 7:129911032-129911054 GGTGGTCGCAATGGAGGGCAGGG + Intronic
1034147057 7:148883582-148883604 GGCCGCTGCCGGGGTGGGCAGGG - Intronic
1034951307 7:155298413-155298435 GGCCGCCAGCAGGGAGGGCCCGG - Exonic
1035187609 7:157138776-157138798 CGCCTCCGCCATTGACGGCACGG - Intergenic
1036079954 8:5544105-5544127 GGAGGCAGCCATGGAAGGCAAGG + Intergenic
1039430612 8:37522226-37522248 GCCCGCCCCCATGGGGAGCAAGG - Intergenic
1039601233 8:38839607-38839629 GGGCACCACCATTGAGGGCAGGG + Intronic
1046965930 8:120165838-120165860 GGCCACACCCATGGAGGTCAGGG + Intronic
1049451808 8:142666038-142666060 GGCAGCCGGCTTGGAGGCCATGG + Exonic
1049668488 8:143859267-143859289 TGCGGCCACCATGGAGGTCAAGG - Exonic
1049668906 8:143860875-143860897 TGCGGCCACCATGGAGGTCAAGG - Exonic
1049669321 8:143862477-143862499 TGCGGCCACCATGGAGGTCAAGG - Exonic
1049669733 8:143864070-143864092 TGCGGCCACCATGGAGGTCAAGG - Exonic
1049670148 8:143865678-143865700 TGCGGCCACCATGGAGGTCAAGG - Exonic
1050610256 9:7344797-7344819 GGCAGCCCTCAGGGAGGGCAGGG + Intergenic
1052647371 9:31254035-31254057 GGCCGCCGCCAAGCAGTGCAAGG + Intergenic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1054828278 9:69595443-69595465 GTCCGAAGCCATGGAGAGCAGGG - Intronic
1056795255 9:89654799-89654821 GCCAGCAGCCATGCAGGGCAAGG - Intergenic
1057030180 9:91769368-91769390 GGCTGCCACCAAGGAGGCCAGGG - Intronic
1060539469 9:124419892-124419914 GGCAGCAGCCATGCTGGGCAGGG - Intergenic
1060820401 9:126658417-126658439 GGCAGGCGGCAGGGAGGGCAGGG - Intronic
1060927371 9:127464365-127464387 GGCCGCCGCTCTGGACAGCACGG - Intronic
1060996600 9:127877662-127877684 GGCCGCCGCGAGGACGGGCAGGG - Exonic
1061061103 9:128250847-128250869 AGCCCCCGGCCTGGAGGGCACGG - Exonic
1062449933 9:136611036-136611058 GGGGGCGGCCATGGGGGGCAGGG + Intergenic
1062529641 9:136994243-136994265 GGCCGCACCCAGGTAGGGCACGG + Intergenic
1062680524 9:137776803-137776825 GGGCTCGGCCCTGGAGGGCAGGG + Exonic
1203779533 EBV:93417-93439 CGTGGCCGTCATGGAGGGCATGG - Intergenic
1186611151 X:11139357-11139379 AGCCCCCGCGACGGAGGGCAGGG - Exonic
1192361824 X:70445374-70445396 GGCCCCCGCCTGCGAGGGCAAGG - Exonic
1197796600 X:130305188-130305210 GGCATCAGCCATGGAGGGCAGGG + Intergenic
1200086116 X:153606765-153606787 GGGCGACGCAGTGGAGGGCAGGG + Intergenic
1200138640 X:153886568-153886590 GGCCGGCGCCGTCGAGGGCCAGG - Intronic
1201424612 Y:13834336-13834358 GGGAGCCGGCATGGAGGGGAAGG - Intergenic
1201729915 Y:17192400-17192422 AGCCGCTGCCCTGTAGGGCAGGG - Intergenic