ID: 1102678173

View in Genome Browser
Species Human (GRCh38)
Location 12:114672479-114672501
Sequence GTCAACACTCAGAAATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102678173 Original CRISPR GTCAACACTCAGAAATCTCT AGG Intronic
900745195 1:4356181-4356203 GTCAACTCTGAGAAATCACAGGG + Intergenic
904855705 1:33496835-33496857 GTCAACATACAGAAAGCCCTGGG - Intergenic
913177598 1:116289064-116289086 CTCTCCACTCAGAACTCTCTTGG - Intergenic
918456284 1:184720105-184720127 GTCAAAGCTGAGAAATATCTAGG - Intronic
918784617 1:188749858-188749880 GCTAACACTCAGAATTCTCTCGG - Intergenic
921231245 1:213073983-213074005 GTACACACTCAGAAATATATCGG + Intronic
923596855 1:235367271-235367293 TTCAGCACTCGGAAATCGCTTGG + Intergenic
1066801945 10:39202608-39202630 GCTAACACTCAAAATTCTCTTGG + Intergenic
1068832851 10:61517822-61517844 GACAACATACAAAAATCTCTGGG - Intergenic
1069120995 10:64568771-64568793 GTTGACACTTAGAAATCTGTAGG + Intergenic
1071523002 10:86342460-86342482 GTCAAGCCTCAGAAGTCTTTTGG + Intronic
1072756616 10:98025765-98025787 GTCAGCACTCTTAAATCACTAGG + Intronic
1074529401 10:114286763-114286785 GTAAGCACTCAGCAAACTCTAGG + Intronic
1076095953 10:127735572-127735594 GACAAAAATCAGAAATCTTTGGG + Intergenic
1077680007 11:4230713-4230735 GTCAAGTTTCAAAAATCTCTAGG + Intergenic
1077681477 11:4245194-4245216 GTCAAGTTTCAAAAATCTCTAGG - Intergenic
1077689418 11:4327288-4327310 GTCAAGTTTCAAAAATCTCTAGG + Intergenic
1081543573 11:44053433-44053455 ATCAACCCTCAGAATCCTCTGGG + Exonic
1083422475 11:62562278-62562300 GCTAACGCTCAAAAATCTCTCGG - Intronic
1089305910 11:117526091-117526113 GACACCACTCAGAAATTCCTGGG - Intronic
1093294358 12:17369590-17369612 GTCAACAGTATGAAAACTCTAGG - Intergenic
1094291457 12:28855229-28855251 GTCAAAATTCAAAAGTCTCTAGG - Intergenic
1097203516 12:57300243-57300265 GTGAACATTCAGAAAGCTTTTGG + Intronic
1098957287 12:76700739-76700761 GTTAACACTCAGAACTTACTAGG + Intergenic
1101020333 12:100547339-100547361 GTCAACTCTCAGAAAACCCTGGG - Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102097629 12:110252934-110252956 GTCCACACTCAGCCATCGCTCGG + Intergenic
1102678173 12:114672479-114672501 GTCAACACTCAGAAATCTCTAGG + Intronic
1111000112 13:82166968-82166990 GTCAATTCTCAGAAATCTCTCGG + Intergenic
1115643170 14:35348360-35348382 GCTAACACTCAAAATTCTCTCGG - Intergenic
1116360507 14:43990055-43990077 GTAGACACCCAGAAAGCTCTAGG + Intergenic
1116403249 14:44534895-44534917 GTCAACACACTGAAACCTCAAGG + Intergenic
1116663935 14:47750544-47750566 GTAAGCAGTGAGAAATCTCTGGG - Intergenic
1117110101 14:52443857-52443879 TTCTAAACTCACAAATCTCTTGG - Intronic
1118408621 14:65452496-65452518 TTCAATACAGAGAAATCTCTAGG - Intronic
1123399626 15:19971596-19971618 GCTAACGCTCAGAATTCTCTCGG + Intergenic
1124871751 15:33550356-33550378 GTGAAAACTCAGAAACCTCCAGG + Intronic
1127508999 15:59621892-59621914 GACAACACTCAGAAAGGGCTGGG - Exonic
1131696845 15:94886485-94886507 ATCAAGAGTCTGAAATCTCTGGG - Intergenic
1132099255 15:99011753-99011775 TTCAAATATCAGAAATCTCTAGG + Intergenic
1134426423 16:14151837-14151859 GCCAAAACTCAGAGCTCTCTAGG + Intronic
1138312684 16:56041623-56041645 GTCAACACTCAGAATTCTTTCGG - Intergenic
1140204161 16:72920235-72920257 ATCAACACCCAGAAGTCACTGGG + Intronic
1140244454 16:73235469-73235491 GTCATAACTCGGAAATCTCCAGG + Intergenic
1144370583 17:14586811-14586833 TAAAACAGTCAGAAATCTCTTGG - Intergenic
1146467155 17:33095389-33095411 GTTAAGACTGAGAGATCTCTTGG + Intronic
1147166763 17:38597658-38597680 GTCTACAGTCAGACAGCTCTGGG - Intronic
1148478557 17:47945275-47945297 CTCAAGACTCACAAATCTGTGGG + Intronic
1148985751 17:51619577-51619599 GTCAACACTCAAAAAAGTTTTGG - Intergenic
1149052044 17:52317111-52317133 GCAAACACTCAAAAATCTCATGG + Intergenic
1203167394 17_GL000205v2_random:110341-110363 GTCAAAACTCAGAAATTTCAGGG + Intergenic
1155926060 18:31656444-31656466 GTCAACACTCAGAAGCCACACGG - Intronic
1156127357 18:33922115-33922137 GTCTTCTCTCAGAGATCTCTTGG - Intronic
1156175612 18:34542036-34542058 GGGAGCACACAGAAATCTCTGGG + Intronic
1156602722 18:38629010-38629032 GTCAACTCTCAGGAATTACTTGG + Intergenic
1159090469 18:63843074-63843096 GGCAACAATCAGATAACTCTAGG - Intergenic
1159834363 18:73319425-73319447 GTCCACACTCACCAATATCTAGG - Intergenic
1159882609 18:73873532-73873554 GTCAATAATCAAAAATCTGTGGG - Intergenic
1159913256 18:74165988-74166010 GGCAACACTCACACTTCTCTAGG - Intergenic
1161903356 19:7136390-7136412 GTCCACACTCAGAAAGTTCTGGG - Intronic
1167055261 19:47106762-47106784 CTGCACACTCAGAAAACTCTTGG + Intronic
925519893 2:4731813-4731835 GCCAACTCTGAGTAATCTCTAGG + Intergenic
925549684 2:5058873-5058895 GTACACACTCATAAAACTCTGGG - Intergenic
926866355 2:17363293-17363315 GTTATCACTCAGAAATTTATGGG - Intergenic
927099515 2:19777144-19777166 GGAAACACACAGAAAACTCTTGG + Intergenic
930483406 2:51979333-51979355 GTCAACAGTCAGAATGCTCCTGG + Intergenic
931453347 2:62386992-62387014 GTCAACACTCAAAAAAATTTTGG - Intergenic
931912697 2:66918972-66918994 ATCAACACACAGAAAACTCCTGG + Intergenic
932576710 2:72966325-72966347 TTCAAGACTCAGCAATCTCAAGG + Intronic
935288154 2:101584264-101584286 GTCAGCATGCAGATATCTCTTGG + Intergenic
939367637 2:141254277-141254299 GTCAACAATCGGAAATGTTTGGG - Intronic
942282939 2:174385291-174385313 ATAAACATTAAGAAATCTCTAGG + Intronic
942356464 2:175117836-175117858 GTCAATACTCAGATATTTCAGGG - Intronic
943447942 2:188012784-188012806 ATCAACACTGAGAAATTTCCTGG + Intergenic
945413254 2:209538104-209538126 GTCTTCACGCAGAAATCTGTTGG + Intronic
945663261 2:212711938-212711960 ACCAACACTCAGAAATCGCTAGG + Intergenic
946009938 2:216556388-216556410 GTCTATACTCAGACATCTGTTGG + Intronic
946603751 2:221379259-221379281 GTCAACCCTCAGTATTCTCAGGG + Intergenic
946753501 2:222918596-222918618 GACAACTCCCAGAAATATCTGGG + Intronic
1170959382 20:21011662-21011684 ATCAACACTGAGATATATCTTGG - Intergenic
1171822433 20:29865656-29865678 GCTAACACTCAAAATTCTCTTGG + Intergenic
1174991909 20:55520683-55520705 GTCAACATACCAAAATCTCTGGG - Intergenic
1176404365 21:6348794-6348816 GTCAAAACTCAGAAATTTCAGGG - Intergenic
1176432792 21:6640310-6640332 GTCAAAACTCAGAAATTTCAGGG + Intergenic
1176586036 21:8586612-8586634 TTCAACCCTCAAAAAACTCTGGG - Intergenic
1177569326 21:22866668-22866690 TTCAAACCTCAGAAAACTCTGGG - Intergenic
1178504322 21:33150753-33150775 GACATGACTTAGAAATCTCTAGG - Intergenic
1180268844 22:10563518-10563540 TTCAACCCTCAAAAAACTCTGGG - Intergenic
949164757 3:925847-925869 CTTAACACTGAGAAATATCTAGG - Intergenic
949367540 3:3299405-3299427 GTAAACACTCAGAAATATGATGG - Intergenic
949793090 3:7814949-7814971 CTCAACACACACAAATCTCATGG + Intergenic
949799083 3:7883650-7883672 ATGATCACTCAGAAAACTCTGGG + Intergenic
955360922 3:58274258-58274280 GTCAACACTCAGATATGCTTAGG + Intronic
955665763 3:61347824-61347846 GTCAACAGTAAGAAAGCTATTGG + Intergenic
962742067 3:138369274-138369296 GTAAACACTTAGAAAATTCTAGG + Intronic
967015784 3:185480476-185480498 GTGAAGACTCAGATGTCTCTGGG + Exonic
967159931 3:186726592-186726614 GTCAACTATCAGAAAAGTCTGGG - Intronic
967495093 3:190134186-190134208 GCTAACACTCAAAATTCTCTCGG - Intergenic
967897568 3:194410764-194410786 ATCAATAGTCAGAGATCTCTTGG + Intronic
970028594 4:11651169-11651191 GCCAACACTCAGAAAGCTTCTGG + Intergenic
970151872 4:13098414-13098436 GTCAGGCCTCAGAAATCTTTAGG + Intergenic
973945884 4:55955350-55955372 GTCATCACTCAGAACTCTGCTGG - Intronic
974270669 4:59647154-59647176 GTCAGCACTCAGAAAGTTTTTGG + Intergenic
975619372 4:76280666-76280688 CTCAACACCCTGAATTCTCTAGG + Intronic
976094395 4:81492222-81492244 GTCTTCACTTAGAAATCACTGGG + Intronic
980212706 4:129810665-129810687 GACAAAATTCAGAAAACTCTAGG - Intergenic
982038322 4:151369402-151369424 GCCAACATTCTGAAATTTCTAGG - Intergenic
982107110 4:152020769-152020791 GTCAACAACCAGAATTCACTTGG + Intergenic
982772545 4:159410823-159410845 GTCAGCACTGAGAGCTCTCTGGG + Intergenic
983766924 4:171495569-171495591 CTCAACATTCATAAATCTCTGGG + Intergenic
984619777 4:181939387-181939409 GACATCACTCTGAAATCTCCAGG - Intergenic
988044389 5:25931290-25931312 CTCAGCACACACAAATCTCTAGG - Intergenic
991106428 5:62848416-62848438 GTCAACAATCTGAAAAATCTAGG - Intergenic
993037741 5:82775603-82775625 GTCTCCACACAGAAATCTCCAGG - Intergenic
993047486 5:82884529-82884551 GTCCACACTCTTAAATCTCATGG + Intergenic
994101653 5:95900077-95900099 GGCCAAACTCAGAACTCTCTCGG - Intronic
994316295 5:98337407-98337429 GCCAAATATCAGAAATCTCTTGG + Intergenic
995791818 5:115897121-115897143 GTTAACACTAGGCAATCTCTGGG - Intronic
998364600 5:141621135-141621157 TTCATCCCTCAAAAATCTCTGGG + Exonic
1001024894 5:168215756-168215778 GGCAGCAGTCAGAAATCTCCAGG - Intronic
1002074729 5:176701421-176701443 GCTATCACTCAGGAATCTCTGGG + Intergenic
1006406619 6:33849314-33849336 CTCAACACTCAGCAACGTCTTGG + Intergenic
1010643683 6:78361340-78361362 GCCAACTCTCAGACACCTCTTGG - Intergenic
1012326661 6:97928094-97928116 GTCAACAAACAGAAATTTCAAGG - Intergenic
1012931665 6:105323705-105323727 GTCACCTCTCGGAAAACTCTTGG + Exonic
1013630488 6:111981583-111981605 ATCAACACTCAGAACACGCTTGG - Intergenic
1014502759 6:122213213-122213235 GACAAAACTCAGAAATATATAGG + Intergenic
1016917844 6:149261681-149261703 GTCAACAGTCAGACATCCATGGG - Intronic
1018648006 6:165965692-165965714 GTCTACATTTAGAAATGTCTGGG + Intronic
1019110532 6:169707436-169707458 ATCAAAACTAAGAAATCTCTTGG + Intronic
1020771920 7:12405299-12405321 CTGTACACTAAGAAATCTCTGGG - Intergenic
1021233162 7:18110043-18110065 GTCAACTTTCAGAATTGTCTGGG - Intronic
1022445974 7:30471187-30471209 GTCACCACACATAAATCCCTGGG - Intronic
1024013514 7:45291055-45291077 GTGAACACTCAAAAATCTGTTGG + Intergenic
1024188334 7:46978035-46978057 ATAAACACTCAGAAATCCATCGG + Intergenic
1025267187 7:57473096-57473118 ATCAAGACTCAGAAATGTATGGG - Exonic
1026122925 7:67553120-67553142 TTCAACCCTCAGCCATCTCTAGG - Intergenic
1026544885 7:71313373-71313395 GCCAACACTCAGAAACCTGGAGG - Intronic
1030080928 7:105777029-105777051 GTAGACACTCAGAAGTGTCTGGG - Intronic
1030353762 7:108520945-108520967 GTCAACAGTAAAAAATCTCCAGG + Intronic
1031510363 7:122641372-122641394 TTCCACATTCAGAATTCTCTCGG + Intronic
1032420920 7:131778498-131778520 GTCAACAGTCAGAAATCAAGTGG - Intergenic
1033624505 7:143095713-143095735 GCCAAAACTCAGAAAGTTCTGGG + Intergenic
1035134704 7:156690586-156690608 GTCAAGACTTAGACATATCTAGG + Intronic
1038760598 8:30382078-30382100 GTTAAAAGTCAAAAATCTCTGGG - Intergenic
1039954116 8:42194494-42194516 TTCAGCCCACAGAAATCTCTGGG - Intronic
1041715053 8:60924732-60924754 CTCAACCCTCAGAGGTCTCTTGG + Intergenic
1041756563 8:61319656-61319678 GTCAAAACTAAGAAATCTCCAGG - Intronic
1042585223 8:70329761-70329783 TACAACATTCAGAAATCTCATGG + Intronic
1044120544 8:88389131-88389153 ATCAGCAATCAGAACTCTCTAGG - Intergenic
1044209213 8:89530466-89530488 GTCAGCACTGTGTAATCTCTGGG - Intergenic
1045935075 8:107669980-107670002 GCCAAGACTGAGAAATTTCTGGG - Intergenic
1047755078 8:127912286-127912308 GTCAACACGTAGAAATCACTTGG - Intergenic
1051727302 9:20101582-20101604 GACTAAACTCAGACATCTCTGGG + Intergenic
1052221852 9:26033647-26033669 TTTAACACTTTGAAATCTCTTGG + Intergenic
1055704356 9:78981338-78981360 GCCACCTCTCAGAAACCTCTGGG - Intergenic
1056432979 9:86547076-86547098 TTGAATACTCAGACATCTCTGGG - Intergenic
1056851417 9:90087730-90087752 GTCTACACTCAGTAATCTTTTGG + Intergenic
1059719432 9:116945238-116945260 ATCAACTCTCACAAATCACTGGG + Intronic
1203438743 Un_GL000195v1:168360-168382 GTCAAAACTCAGAAATTTCAGGG - Intergenic
1203375492 Un_KI270442v1:372281-372303 GCTAACACTCAAAATTCTCTTGG + Intergenic
1203615942 Un_KI270749v1:64130-64152 TTCAACCCTCAAAAACCTCTGGG - Intergenic
1191411447 X:60409240-60409262 ATCATCACTCAGAAGTTTCTGGG - Intergenic
1191433802 X:60708759-60708781 ATCATCACTCAGAAGTTTCTGGG - Intergenic
1191518396 X:61840708-61840730 ATCATCACTCAGAAGTTTCTGGG - Intergenic
1194183363 X:90740202-90740224 GTCAACACACCAGAATCTCTAGG + Intergenic
1196944957 X:120814572-120814594 GCTAACGCTCAGAATTCTCTTGG - Intergenic
1199237690 X:145509947-145509969 GTCATCACTCTTAAATCCCTAGG - Intergenic
1200529978 Y:4322149-4322171 GTCAACACACCAGAATCTCTAGG + Intergenic
1200825107 Y:7629704-7629726 GATAACGCTCAGAATTCTCTCGG + Intergenic
1202234948 Y:22701382-22701404 GATAACGCTCAGAATTCTCTCGG - Intergenic
1202308211 Y:23494786-23494808 GATAACGCTCAGAATTCTCTCGG + Intergenic
1202562590 Y:26175800-26175822 GATAACGCTCAGAATTCTCTCGG - Intergenic