ID: 1102679816

View in Genome Browser
Species Human (GRCh38)
Location 12:114683867-114683889
Sequence CAGAGGAAGGAGGAGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4486
Summary {0: 1, 1: 8, 2: 66, 3: 683, 4: 3728}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102679816_1102679827 3 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679827 12:114683893-114683915 CGAGCCTCCGGAGGGTGTCTCGG 0: 1
1: 0
2: 0
3: 2
4: 84
1102679816_1102679824 -6 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679824 12:114683884-114683906 CCTCTGCTCCGAGCCTCCGGAGG 0: 1
1: 0
2: 5
3: 15
4: 191
1102679816_1102679831 25 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679831 12:114683915-114683937 GTTTCAATCCAAATCTTGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 114
1102679816_1102679830 24 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679830 12:114683914-114683936 GGTTTCAATCCAAATCTTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1102679816_1102679822 -9 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679822 12:114683881-114683903 CTTCCTCTGCTCCGAGCCTCCGG 0: 1
1: 0
2: 2
3: 25
4: 328
1102679816_1102679825 -5 Left 1102679816 12:114683867-114683889 CCGCCCTCCTCCTCCTTCCTCTG 0: 1
1: 8
2: 66
3: 683
4: 3728
Right 1102679825 12:114683885-114683907 CTCTGCTCCGAGCCTCCGGAGGG 0: 1
1: 0
2: 2
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102679816 Original CRISPR CAGAGGAAGGAGGAGGAGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr