ID: 1102680654

View in Genome Browser
Species Human (GRCh38)
Location 12:114688253-114688275
Sequence TGGGGCACTGGGCAGAAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102680654_1102680657 -6 Left 1102680654 12:114688253-114688275 CCTCGTTTCTGCCCAGTGCCCCA 0: 1
1: 0
2: 1
3: 26
4: 232
Right 1102680657 12:114688270-114688292 GCCCCAGCCCATTTGATCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102680654 Original CRISPR TGGGGCACTGGGCAGAAACG AGG (reversed) Intergenic