ID: 1102681994

View in Genome Browser
Species Human (GRCh38)
Location 12:114697127-114697149
Sequence AGGCGTCTTTGCAAAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102681994_1102681999 20 Left 1102681994 12:114697127-114697149 CCACCAGCTTTGCAAAGACGCCT No data
Right 1102681999 12:114697170-114697192 GTTCTGTCCTAGACTTCGTTCGG No data
1102681994_1102681996 -9 Left 1102681994 12:114697127-114697149 CCACCAGCTTTGCAAAGACGCCT No data
Right 1102681996 12:114697141-114697163 AAGACGCCTGCGATTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102681994 Original CRISPR AGGCGTCTTTGCAAAGCTGG TGG (reversed) Intergenic
No off target data available for this crispr