ID: 1102683947

View in Genome Browser
Species Human (GRCh38)
Location 12:114709707-114709729
Sequence CCTTTTAAGAAATCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102683947_1102683952 1 Left 1102683947 12:114709707-114709729 CCAGCCCCAGATTTCTTAAAAGG No data
Right 1102683952 12:114709731-114709753 CATCACATAATTCATAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102683947 Original CRISPR CCTTTTAAGAAATCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr