ID: 1102685400

View in Genome Browser
Species Human (GRCh38)
Location 12:114720944-114720966
Sequence AGTGCTTAAGCATCCCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102685400_1102685412 17 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685412 12:114720984-114721006 GGAAGCAGGGGCCGGAACTGGGG No data
1102685400_1102685404 -4 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685404 12:114720963-114720985 CACTCTGGGGCCAGCAATAGAGG No data
1102685400_1102685406 4 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685406 12:114720971-114720993 GGCCAGCAATAGAGGAAGCAGGG No data
1102685400_1102685407 5 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685407 12:114720972-114720994 GCCAGCAATAGAGGAAGCAGGGG No data
1102685400_1102685411 16 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685411 12:114720983-114721005 AGGAAGCAGGGGCCGGAACTGGG No data
1102685400_1102685413 24 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685413 12:114720991-114721013 GGGGCCGGAACTGGGGTGTATGG No data
1102685400_1102685405 3 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685405 12:114720970-114720992 GGGCCAGCAATAGAGGAAGCAGG No data
1102685400_1102685409 9 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685409 12:114720976-114720998 GCAATAGAGGAAGCAGGGGCCGG No data
1102685400_1102685410 15 Left 1102685400 12:114720944-114720966 CCAACAAGGGATGCTTAAGCACT No data
Right 1102685410 12:114720982-114721004 GAGGAAGCAGGGGCCGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102685400 Original CRISPR AGTGCTTAAGCATCCCTTGT TGG (reversed) Intergenic