ID: 1102692075

View in Genome Browser
Species Human (GRCh38)
Location 12:114769291-114769313
Sequence GCGGGAGGGTACCTGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102692075_1102692084 -1 Left 1102692075 12:114769291-114769313 CCTGACCTCAGGTACCCTCCCGC No data
Right 1102692084 12:114769313-114769335 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
1102692075_1102692082 -2 Left 1102692075 12:114769291-114769313 CCTGACCTCAGGTACCCTCCCGC No data
Right 1102692082 12:114769312-114769334 GCCTTGGCCTCCCAAAGTGCTGG 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
1102692075_1102692086 7 Left 1102692075 12:114769291-114769313 CCTGACCTCAGGTACCCTCCCGC No data
Right 1102692086 12:114769321-114769343 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102692075 Original CRISPR GCGGGAGGGTACCTGAGGTC AGG (reversed) Intergenic
No off target data available for this crispr