ID: 1102694724

View in Genome Browser
Species Human (GRCh38)
Location 12:114789866-114789888
Sequence CTCAAGGAGCTGCCTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102694724_1102694728 5 Left 1102694724 12:114789866-114789888 CCCACTGGAGGCAGCTCCTTGAG No data
Right 1102694728 12:114789894-114789916 TCTGTTATTATTCTCCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102694724 Original CRISPR CTCAAGGAGCTGCCTCCAGT GGG (reversed) Intergenic
No off target data available for this crispr