ID: 1102698331

View in Genome Browser
Species Human (GRCh38)
Location 12:114817426-114817448
Sequence GCAAACTAAACAACAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102698331_1102698339 19 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698339 12:114817468-114817490 GCCGGGAAGTGAACTGGGCAAGG No data
1102698331_1102698341 22 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698341 12:114817471-114817493 GGGAAGTGAACTGGGCAAGGAGG No data
1102698331_1102698338 14 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698338 12:114817463-114817485 TCTAAGCCGGGAAGTGAACTGGG No data
1102698331_1102698333 1 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698333 12:114817450-114817472 TTAAGCAGCCTCCTCTAAGCCGG No data
1102698331_1102698334 2 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698334 12:114817451-114817473 TAAGCAGCCTCCTCTAAGCCGGG No data
1102698331_1102698337 13 Left 1102698331 12:114817426-114817448 CCTTCCTTTGTTGTTTAGTTTGC No data
Right 1102698337 12:114817462-114817484 CTCTAAGCCGGGAAGTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102698331 Original CRISPR GCAAACTAAACAACAAAGGA AGG (reversed) Intergenic
No off target data available for this crispr