ID: 1102702024

View in Genome Browser
Species Human (GRCh38)
Location 12:114847693-114847715
Sequence CTTTCCAAACAGGAGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102702015_1102702024 -9 Left 1102702015 12:114847679-114847701 CCTTGCCAGCCCAACTTTCCAAA No data
Right 1102702024 12:114847693-114847715 CTTTCCAAACAGGAGTTGGGGGG No data
1102702013_1102702024 3 Left 1102702013 12:114847667-114847689 CCAATCCAACTGCCTTGCCAGCC No data
Right 1102702024 12:114847693-114847715 CTTTCCAAACAGGAGTTGGGGGG No data
1102702012_1102702024 21 Left 1102702012 12:114847649-114847671 CCGCTGAAGGGGTCTCAGCCAAT No data
Right 1102702024 12:114847693-114847715 CTTTCCAAACAGGAGTTGGGGGG No data
1102702014_1102702024 -2 Left 1102702014 12:114847672-114847694 CCAACTGCCTTGCCAGCCCAACT No data
Right 1102702024 12:114847693-114847715 CTTTCCAAACAGGAGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102702024 Original CRISPR CTTTCCAAACAGGAGTTGGG GGG Intergenic
No off target data available for this crispr