ID: 1102703078

View in Genome Browser
Species Human (GRCh38)
Location 12:114856779-114856801
Sequence CAGGTAGCACATGTTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102703078_1102703083 7 Left 1102703078 12:114856779-114856801 CCAACCCAAACATGTGCTACCTG No data
Right 1102703083 12:114856809-114856831 AATTTGCCAGGCTACCATCTTGG No data
1102703078_1102703081 -5 Left 1102703078 12:114856779-114856801 CCAACCCAAACATGTGCTACCTG No data
Right 1102703081 12:114856797-114856819 ACCTGTTGTAATAATTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102703078 Original CRISPR CAGGTAGCACATGTTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr