ID: 1102709626 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:114914736-114914758 |
Sequence | CTACATGCCTTGTATCTGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1102709624_1102709626 | 4 | Left | 1102709624 | 12:114914709-114914731 | CCAGGACTTAGAGACACGGCTTT | No data | ||
Right | 1102709626 | 12:114914736-114914758 | CTACATGCCTTGTATCTGCAGGG | No data | ||||
1102709622_1102709626 | 8 | Left | 1102709622 | 12:114914705-114914727 | CCAGCCAGGACTTAGAGACACGG | No data | ||
Right | 1102709626 | 12:114914736-114914758 | CTACATGCCTTGTATCTGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1102709626 | Original CRISPR | CTACATGCCTTGTATCTGCA GGG | Intergenic | ||
No off target data available for this crispr |