ID: 1102709626

View in Genome Browser
Species Human (GRCh38)
Location 12:114914736-114914758
Sequence CTACATGCCTTGTATCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102709624_1102709626 4 Left 1102709624 12:114914709-114914731 CCAGGACTTAGAGACACGGCTTT No data
Right 1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG No data
1102709622_1102709626 8 Left 1102709622 12:114914705-114914727 CCAGCCAGGACTTAGAGACACGG No data
Right 1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102709626 Original CRISPR CTACATGCCTTGTATCTGCA GGG Intergenic
No off target data available for this crispr