ID: 1102709627

View in Genome Browser
Species Human (GRCh38)
Location 12:114914743-114914765
Sequence CCTCAAGCCCTGCAGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102709627_1102709632 25 Left 1102709627 12:114914743-114914765 CCTTGTATCTGCAGGGCTTGAGG No data
Right 1102709632 12:114914791-114914813 CCCGGATTCTCAGCTAACCAAGG No data
1102709627_1102709634 30 Left 1102709627 12:114914743-114914765 CCTTGTATCTGCAGGGCTTGAGG No data
Right 1102709634 12:114914796-114914818 ATTCTCAGCTAACCAAGGAAAGG No data
1102709627_1102709630 7 Left 1102709627 12:114914743-114914765 CCTTGTATCTGCAGGGCTTGAGG No data
Right 1102709630 12:114914773-114914795 GCTGCTTTTGTTCAAGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102709627 Original CRISPR CCTCAAGCCCTGCAGATACA AGG (reversed) Intergenic
No off target data available for this crispr