ID: 1102709844

View in Genome Browser
Species Human (GRCh38)
Location 12:114916248-114916270
Sequence CTCGCCTTCAGCCATGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102709844_1102709847 1 Left 1102709844 12:114916248-114916270 CCAACATCATGGCTGAAGGCGAG No data
Right 1102709847 12:114916272-114916294 AAAGGTCATCTGTAAGTGCTTGG No data
1102709844_1102709848 26 Left 1102709844 12:114916248-114916270 CCAACATCATGGCTGAAGGCGAG No data
Right 1102709848 12:114916297-114916319 TGTGTGTCCATCCTGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102709844 Original CRISPR CTCGCCTTCAGCCATGATGT TGG (reversed) Intergenic
No off target data available for this crispr