ID: 1102709878

View in Genome Browser
Species Human (GRCh38)
Location 12:114916547-114916569
Sequence GAGGGGAAGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102709878_1102709887 25 Left 1102709878 12:114916547-114916569 CCTTCCTCCTTCTTCTTCCCCTC No data
Right 1102709887 12:114916595-114916617 AAGACTTAGAAAGTCCCACTGGG No data
1102709878_1102709881 -7 Left 1102709878 12:114916547-114916569 CCTTCCTCCTTCTTCTTCCCCTC No data
Right 1102709881 12:114916563-114916585 TCCCCTCGTACTCCTCTTCAAGG No data
1102709878_1102709886 24 Left 1102709878 12:114916547-114916569 CCTTCCTCCTTCTTCTTCCCCTC No data
Right 1102709886 12:114916594-114916616 AAAGACTTAGAAAGTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102709878 Original CRISPR GAGGGGAAGAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr