ID: 1102713774

View in Genome Browser
Species Human (GRCh38)
Location 12:114952404-114952426
Sequence GGTGCAGGAGACCACACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102713774_1102713782 23 Left 1102713774 12:114952404-114952426 CCCGCAGTGTGGTCTCCTGCACC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102713774 Original CRISPR GGTGCAGGAGACCACACTGC GGG (reversed) Intergenic
No off target data available for this crispr