ID: 1102713782

View in Genome Browser
Species Human (GRCh38)
Location 12:114952450-114952472
Sequence CTTAACCTGCCATGTTGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102713774_1102713782 23 Left 1102713774 12:114952404-114952426 CCCGCAGTGTGGTCTCCTGCACC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713773_1102713782 26 Left 1102713773 12:114952401-114952423 CCACCCGCAGTGTGGTCTCCTGC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713777_1102713782 2 Left 1102713777 12:114952425-114952447 CCCTCTATGTGCCCTCCTTAGAA No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713776_1102713782 8 Left 1102713776 12:114952419-114952441 CCTGCACCCTCTATGTGCCCTCC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713778_1102713782 1 Left 1102713778 12:114952426-114952448 CCTCTATGTGCCCTCCTTAGAAC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713780_1102713782 -10 Left 1102713780 12:114952437-114952459 CCTCCTTAGAACTCTTAACCTGC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713779_1102713782 -9 Left 1102713779 12:114952436-114952458 CCCTCCTTAGAACTCTTAACCTG No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data
1102713775_1102713782 22 Left 1102713775 12:114952405-114952427 CCGCAGTGTGGTCTCCTGCACCC No data
Right 1102713782 12:114952450-114952472 CTTAACCTGCCATGTTGCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102713782 Original CRISPR CTTAACCTGCCATGTTGCTA CGG Intergenic