ID: 1102714714

View in Genome Browser
Species Human (GRCh38)
Location 12:114960357-114960379
Sequence TGAACTCTGCTTGGGCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102714707_1102714714 6 Left 1102714707 12:114960328-114960350 CCTCAGTTTGGTTTTAGCTACCT No data
Right 1102714714 12:114960357-114960379 TGAACTCTGCTTGGGCAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102714714 Original CRISPR TGAACTCTGCTTGGGCAAGG GGG Intergenic
No off target data available for this crispr