ID: 1102720570

View in Genome Browser
Species Human (GRCh38)
Location 12:115012854-115012876
Sequence GTGAAGAAGAGGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102720570_1102720574 -4 Left 1102720570 12:115012854-115012876 CCTGGCTCCTTCCTCTTCTTCAC No data
Right 1102720574 12:115012873-115012895 TCACTTGCTTCTGACAGTCAGGG No data
1102720570_1102720573 -5 Left 1102720570 12:115012854-115012876 CCTGGCTCCTTCCTCTTCTTCAC No data
Right 1102720573 12:115012872-115012894 TTCACTTGCTTCTGACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102720570 Original CRISPR GTGAAGAAGAGGAAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr