ID: 1102721010

View in Genome Browser
Species Human (GRCh38)
Location 12:115016062-115016084
Sequence TCCAACAGAGAAGTGTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102721010_1102721014 29 Left 1102721010 12:115016062-115016084 CCACATGACACTTCTCTGTTGGA No data
Right 1102721014 12:115016114-115016136 ATATTTCTGGCTTATTCTCAAGG No data
1102721010_1102721013 16 Left 1102721010 12:115016062-115016084 CCACATGACACTTCTCTGTTGGA No data
Right 1102721013 12:115016101-115016123 TGCAGGTGACAGCATATTTCTGG No data
1102721010_1102721012 -1 Left 1102721010 12:115016062-115016084 CCACATGACACTTCTCTGTTGGA No data
Right 1102721012 12:115016084-115016106 ATCTACTTGGAAGTTCTTGCAGG No data
1102721010_1102721015 30 Left 1102721010 12:115016062-115016084 CCACATGACACTTCTCTGTTGGA No data
Right 1102721015 12:115016115-115016137 TATTTCTGGCTTATTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102721010 Original CRISPR TCCAACAGAGAAGTGTCATG TGG (reversed) Intergenic
No off target data available for this crispr