ID: 1102728248

View in Genome Browser
Species Human (GRCh38)
Location 12:115084888-115084910
Sequence ATCCATACGGCCCTCACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102728248_1102728260 -5 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728260 12:115084906-115084928 TGGATGGCTGGGGGGAGGGAGGG No data
1102728248_1102728258 -9 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728258 12:115084902-115084924 CGTATGGATGGCTGGGGGGAGGG No data
1102728248_1102728261 1 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728261 12:115084912-115084934 GCTGGGGGGAGGGAGGGAAAAGG No data
1102728248_1102728262 2 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data
1102728248_1102728259 -6 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728259 12:115084905-115084927 ATGGATGGCTGGGGGGAGGGAGG No data
1102728248_1102728257 -10 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728257 12:115084901-115084923 CCGTATGGATGGCTGGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102728248 Original CRISPR ATCCATACGGCCCTCACAAT GGG (reversed) Intergenic
No off target data available for this crispr