ID: 1102728262

View in Genome Browser
Species Human (GRCh38)
Location 12:115084913-115084935
Sequence CTGGGGGGAGGGAGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102728244_1102728262 11 Left 1102728244 12:115084879-115084901 CCTCTCCTCCCCATTGTGAGGGC No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data
1102728249_1102728262 1 Left 1102728249 12:115084889-115084911 CCATTGTGAGGGCCGTATGGATG No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data
1102728247_1102728262 3 Left 1102728247 12:115084887-115084909 CCCCATTGTGAGGGCCGTATGGA No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data
1102728248_1102728262 2 Left 1102728248 12:115084888-115084910 CCCATTGTGAGGGCCGTATGGAT No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data
1102728245_1102728262 6 Left 1102728245 12:115084884-115084906 CCTCCCCATTGTGAGGGCCGTAT No data
Right 1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102728262 Original CRISPR CTGGGGGGAGGGAGGGAAAA GGG Intergenic
No off target data available for this crispr