ID: 1102736104

View in Genome Browser
Species Human (GRCh38)
Location 12:115161105-115161127
Sequence CAGTAGGAAGGGAAGGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102736094_1102736104 27 Left 1102736094 12:115161055-115161077 CCTCCTATAGCCAAGACAGGAGA No data
Right 1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG No data
1102736097_1102736104 17 Left 1102736097 12:115161065-115161087 CCAAGACAGGAGATGCTAGGAGA No data
Right 1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG No data
1102736095_1102736104 24 Left 1102736095 12:115161058-115161080 CCTATAGCCAAGACAGGAGATGC No data
Right 1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102736104 Original CRISPR CAGTAGGAAGGGAAGGAAGG CGG Intergenic
No off target data available for this crispr