ID: 1102737785

View in Genome Browser
Species Human (GRCh38)
Location 12:115178699-115178721
Sequence TTTAGGGTCTTCAACAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102737785_1102737791 13 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737791 12:115178735-115178757 TCTCTACAATTGGGCTTTCCTGG No data
1102737785_1102737792 20 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data
1102737785_1102737790 4 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737790 12:115178726-115178748 GTTCAATCTTCTCTACAATTGGG No data
1102737785_1102737789 3 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737789 12:115178725-115178747 GGTTCAATCTTCTCTACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102737785 Original CRISPR TTTAGGGTCTTCAACAGTTG AGG (reversed) Intergenic
No off target data available for this crispr