ID: 1102737789

View in Genome Browser
Species Human (GRCh38)
Location 12:115178725-115178747
Sequence GGTTCAATCTTCTCTACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102737784_1102737789 4 Left 1102737784 12:115178698-115178720 CCCTCAACTGTTGAAGACCCTAA No data
Right 1102737789 12:115178725-115178747 GGTTCAATCTTCTCTACAATTGG No data
1102737783_1102737789 5 Left 1102737783 12:115178697-115178719 CCCCTCAACTGTTGAAGACCCTA No data
Right 1102737789 12:115178725-115178747 GGTTCAATCTTCTCTACAATTGG No data
1102737785_1102737789 3 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737789 12:115178725-115178747 GGTTCAATCTTCTCTACAATTGG No data
1102737782_1102737789 21 Left 1102737782 12:115178681-115178703 CCTGTTTTCAATTTATCCCCTCA No data
Right 1102737789 12:115178725-115178747 GGTTCAATCTTCTCTACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102737789 Original CRISPR GGTTCAATCTTCTCTACAAT TGG Intergenic
No off target data available for this crispr