ID: 1102737792

View in Genome Browser
Species Human (GRCh38)
Location 12:115178742-115178764
Sequence AATTGGGCTTTCCTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102737783_1102737792 22 Left 1102737783 12:115178697-115178719 CCCCTCAACTGTTGAAGACCCTA No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data
1102737785_1102737792 20 Left 1102737785 12:115178699-115178721 CCTCAACTGTTGAAGACCCTAAA No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data
1102737787_1102737792 4 Left 1102737787 12:115178715-115178737 CCCTAAAAATGGTTCAATCTTCT No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data
1102737788_1102737792 3 Left 1102737788 12:115178716-115178738 CCTAAAAATGGTTCAATCTTCTC No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data
1102737784_1102737792 21 Left 1102737784 12:115178698-115178720 CCCTCAACTGTTGAAGACCCTAA No data
Right 1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102737792 Original CRISPR AATTGGGCTTTCCTGGTCCC AGG Intergenic
No off target data available for this crispr