ID: 1102738025

View in Genome Browser
Species Human (GRCh38)
Location 12:115180415-115180437
Sequence CCTCACTTGTAAACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102738019_1102738025 30 Left 1102738019 12:115180362-115180384 CCAGCCTCATTTTACAGGTACTT No data
Right 1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG No data
1102738020_1102738025 26 Left 1102738020 12:115180366-115180388 CCTCATTTTACAGGTACTTTCCT No data
Right 1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG No data
1102738021_1102738025 6 Left 1102738021 12:115180386-115180408 CCTCTCTCATCTTCTCTGAGCCT No data
Right 1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102738025 Original CRISPR CCTCACTTGTAAACTGAGGA TGG Intergenic
No off target data available for this crispr