ID: 1102738473

View in Genome Browser
Species Human (GRCh38)
Location 12:115184714-115184736
Sequence TTGGGTTCTGGAGATGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102738473_1102738477 2 Left 1102738473 12:115184714-115184736 CCTGCTGCATCTCCAGAACCCAA No data
Right 1102738477 12:115184739-115184761 TGCAGACATATTGCATGTCCTGG No data
1102738473_1102738479 24 Left 1102738473 12:115184714-115184736 CCTGCTGCATCTCCAGAACCCAA No data
Right 1102738479 12:115184761-115184783 GAAAATGTTTGTTGAATGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102738473 Original CRISPR TTGGGTTCTGGAGATGCAGC AGG (reversed) Intergenic
No off target data available for this crispr